Stem-loop sequence mmu-mir-7689

AccessionMI0025042 (change log)
Symbol MGI:Mir7689
DescriptionMus musculus miR-7689 stem-loop
Stem-loop
   ---  g      c       ---   -g aaa 
5'    cc aggcag cuggcuu   agu  g   a
      || |||||| |||||||   |||  |    
3'    gg uccguc gaccgag   ucg  c   g
   uuu  g      a       auu   ga aag 
Get sequence
Deep sequencing
757 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 36301570-36301628 [+]
antisense
OTTMUST00000069382 ; Sorcs2-001; intron 1
OTTMUST00000069384 ; Sorcs2-003; intron 1
OTTMUST00000069383 ; Sorcs2-002; intron 1
OTTMUST00000069385 ; Sorcs2-004; intron 2
ENSMUST00000037370 ; Sorcs2-001; intron 1
ENSMUST00000137040 ; Sorcs2-003; intron 1
ENSMUST00000070720 ; Sorcs2-002; intron 1
ENSMUST00000141508 ; Sorcs2-004; intron 2
Database links

Mature sequence mmu-miR-7689-5p

Accession MIMAT0029908
Sequence

1 - 

ccgaggcagccuggcuuag

 - 19

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7689-3p

Accession MIMAT0029909
Sequence

37 - 

uuagagccagacugccuggguuu

 - 59

Get sequence
Deep sequencing739 reads, 44 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1