Stem-loop sequence aly-MIR166h

AccessionMI0026012 (change log)
DescriptionArabidopsis lyrata miR166h stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
        c   u      u      cu   g c   uc    -    --g     g 
5' aaguu agg gaauga gccugg  cga a cau  cauc ucau   aucau a
   ||||| ||| |||||| ||||||  ||| | |||  |||| ||||   |||||  
3' uucaa ucc cuuacu cggacc  gcu u gua  guag agua   uagua u
        c   c      u      ag   g a   --    u    aua     g 
Get sequence
Deep sequencing
134 reads, 4.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL349043.1: 5720-5824 [-]
intergenic
Database links

Mature sequence aly-miR166h-5p

Accession MIMAT0031382
Sequence

10 - 

ugaaugaugccuggcucgaga

 - 30

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166h-3p

Accession MIMAT0031383
Sequence

78 - 

ucggaccaggcuucauucccc

 - 98

Get sequence
Deep sequencing134 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2