Stem-loop sequence aly-MIR2111c

AccessionMI0026013 (change log)
DescriptionArabidopsis lyrata miR2111c stem-loop
Gene family MIPF0000754; MIR2111
Stem-loop
         ---       uc                    -uuu      uaauuuaagcagaaaauuuguau 
5' guauug   gugagga  ggguaaucugcauccugagg    aaagcu                       a
   ||||||   |||||||  ||||||||||||||||||||    ||||||                       c
3' cauaac   cauuccu  uccauuaggcguagggcucc    uuucga                       g
         auu       uc                    ugau      uaugguuguguguaugcauauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348768.1: 2630-2770 [-]
intergenic
Database links

Mature sequence aly-miR2111c-5p

Accession MIMAT0031384
Sequence

19 - 

uaaucugcauccugagguuua

 - 39

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR2111c-3p

Accession MIMAT0031385
Sequence

102 - 

guccucgggaugcggauuacc

 - 122

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2