Stem-loop sequence aly-MIR173b

AccessionMI0026015 (change log)
DescriptionArabidopsis lyrata miR173b stem-loop
Stem-loop
     u  c     a            g      a      u  uca    uua 
5' gg ga uaagu cuuucgcuugca agagaa ucacag gg   aaag   a
   || || ||||| |||||||||||| |||||| |||||| ||   ||||   a
3' cc cu guucg gaaggugaacgu ucucuu aguguc cc   uuuc   g
     -  c     a            g      -      u  ---    ucu 
Get sequence
Deep sequencing
245 reads, 7.5e+03 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348813.1: 3737-3836 [-]
intergenic
Database links

Mature sequence aly-miR173b-5p

Accession MIMAT0031388
Sequence

15 - 

uucgcuugcagagagaaaucac

 - 36

Get sequence
Deep sequencing63 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR173b-3p

Accession MIMAT0031389
Sequence

69 - 

gauucucugugcaaguggaag

 - 89

Get sequence
Deep sequencing182 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2