Stem-loop sequence sma-mir-8458

AccessionMI0027255 (change log)
DescriptionSchistosoma mansoni miR-8458 stem-loop
Literature search

1 open access papers mention sma-mir-8458
(1 sentences)

Stem-loop
   ucuc         c aaa    acg a       -  -   g  a       uc  ucucc  uca 
5'     ugaugggcc c   uaag   a uuaaauu cc agu au gccacua  ca     gu   a
       ||||||||| |   ||||   | ||||||| || ||| || |||||||  ||     ||    
3'     acuacucgg g   auuc   u gauuuga gg uca ua cgguggu  gu     ca   a
   guua         a aaa    -aa a       u  a   a  a       ca  --uuc  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_7.unplaced.SC_0100: 1103164-1103292 [+]
intergenic
Database links

Mature sequence sma-miR-8458-5p

Accession MIMAT0033628
Sequence

38 - 

gugauagccacuauccaucucc

 - 59

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-8458-3p

Accession MIMAT0033629
Sequence

71 - 

ccuuugacugguggcaaua

 - 89

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).