Stem-loop sequence tae-MIR9652

AccessionMI0030369 (change log)
DescriptionTriticum aestivum miR9652 stem-loop
Literature search

1 open access papers mention tae-MIR9652
(6 sentences)

Stem-loop
   ---cua     a            c     g             u         --   -a  u 
5'       uugag uguguuugucac uguuu ucauuaaguuucu agugccuuu  gcc  uc u
         ||||| |||||||||||| ||||| ||||||||||||| |||||||||  |||  || a
3'       agcuu augcaaacagug acaag aguaauucgaaga ucauggaaa  ugg  ag g
   aggcgg     c            u     -             u         ac   ga  u 
Get sequence
Deep sequencing
87436 reads, 281 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2D: 143094648-143094771 [-]
intergenic
Database links

Mature sequence tae-miR9652-5p

Accession MIMAT0035758
Sequence

21 - 

ccuguuugucauuaaguuucuu

 - 42

Get sequence
Deep sequencing75392 reads, 116 experiments
Evidence experimental; Illumina [1]

Mature sequence tae-miR9652-3p

Accession MIMAT0035759
Sequence

84 - 

aagcuuaaugagaacaugug

 - 103

Get sequence
Deep sequencing11808 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).