Stem-loop sequence tae-MIR9657c

AccessionMI0030417 (change log)
DescriptionTriticum aestivum miR9657c stem-loop
Gene family MIPF0001955; MIR9657
Stem-loop
   --  aua    -ag  c  g u       c  ga         u  gga 
5'   gc   gcgg   gg ug c ccguucg cg  gaagcaugu gu   c
     ||   ||||   || || | ||||||| ||  ||||||||| ||    
3'   cg   cguu   cc gc g ggcaagc gc  cuucgugcg cg   c
   cg  -ca    gua  a  g u       u  uc         c  uga 
Get sequence
Deep sequencing
51653 reads, 235 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9657c-3p

Accession MIMAT0035807
Sequence

56 - 

cgugcuuccucgucgaacggu

 - 76

Get sequence
Deep sequencing31008 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).