Stem-loop sequence tae-MIR5049

AccessionMI0030419 (change log)
DescriptionTriticum aestivum miR5049 stem-loop
Gene family MIPF0001200; MIR5067
Literature search

7 open access papers mention tae-MIR5049
(11 sentences)

Stem-loop
   acggaaggau           a          c ua            c     ac 
5'           guacuuccucc auccguauua u  ucuuagauuugu uagau  a
             ||||||||||| |||||||||| |  |||||||||||| |||||   
3'           caugagggagg uagguauaau a  agaauuuaaaca auuua  u
   aauaauaguc           c          a gc            u     ca 
Get sequence
Deep sequencing
227589 reads, 409 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR5049-3p

Accession MIMAT0035809
Sequence

84 - 

aauauggaucggagggaguac

 - 104

Get sequence
Deep sequencing191424 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).