Stem-loop sequence tae-MIR9657b

AccessionMI0030420 (change log)
DescriptionTriticum aestivum miR9657b stem-loop
Gene family MIPF0001955; MIR9657
Literature search

2 open access papers mention tae-MIR9657b
(5 sentences)

Stem-loop
   ---aua        -cuga u       u  ga         u   ga 
5'       gcggcgug     c ccguucg cg  gaagcaugu gcg  c
         ||||||||     | ||||||| ||  ||||||||| |||   
3'       cguugcac     g ggcaagc gc  cuucgugcg cgc  c
   cgcgca        cagcg u       u  uc         c   ga 
Get sequence
Deep sequencing
48918 reads, 235 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9657b-5p

Accession MIMAT0035810
Sequence

21 - 

uucgucggagaagcauguugc

 - 41

Get sequence
Deep sequencing17862 reads, 116 experiments
Evidence experimental; Illumina [1]

Mature sequence tae-miR9657b-3p

Accession MIMAT0035811
Sequence

54 - 

cgugcuuccucgucgaacggu

 - 74

Get sequence
Deep sequencing31018 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).