Stem-loop sequence sfr-mir-277-1

AccessionMI0033568 (change log)
DescriptionSpodoptera frugiperda miR-277-1 stem-loop
Stem-loop
            a  -          -            aagcacgcuacaaguuug 
5' acgcuccgg gu ucgugccagg agugcguuugca                  c
   ||||||||| || |||||||||| ||||||||||||                   
3' ugugaggcc ca agcauggucu ucacguaaaugu                  g
            c  c          a            cacaguugaaacggaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02003144.1: 30110-30217 [+]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-277-1
sfr-mir-277-1JQCY02003144.1: 30110-30217 [+]
sfr-mir-34JQCY02003144.1: 38956-39039 [+]
Database links

Mature sequence sfr-miR-277-5p

Accession MIMAT0041818
Sequence

14 - 

cgugccaggagugcguuugca

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-277-3p

Accession MIMAT0041819
Sequence

75 - 

uaaaugcacuaucugguacgaca

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).