Stem-loop sequence mes-MIR482b

AccessionMI0037912 (change log)
DescriptionManihot esculenta miR482b stem-loop
Literature search

1 open access papers mention mes-MIR482b
(1 sentences)

Stem-loop
   ---  au  a     a        ug a          -gu       -     -ca       -aaauac   aaca     
5'    ag  ag gagcu cuggaagu  u ggaaugggcg   uugggaa aaaau   uauacau       gau    gauu 
      ||  || ||||| ||||||||  | ||||||||||   ||||||| |||||   |||||||       |||    ||| a
3'    uc  uc cucga gaccuuua  a ccuuacccgc   aacccuu uuuug   auaugug       cua    cugc 
   cuu  cc  -     a        gu g          ugu       c     aac       aauuaaa   aaag     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04043: 391302-391458 [-]
intergenic
Database links

Mature sequence mes-miR482b

Accession MIMAT0045976
Sequence

111 - 

uucccaaugucgcccauuccga

 - 132

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).