Stem-loop sequence mes-MIR6445

AccessionMI0037920 (change log)
DescriptionManihot esculenta miR6445 stem-loop
Literature search

1 open access papers mention mes-MIR6445
(4 sentences)

Stem-loop
   --cgccuuc   c      g    c          u            gu       ---------  uu   uu 
5'          guc cucuga gacg uguucauucc cuuccuaaaaug  uucccuu         uc  cuc  u
            ||| |||||| |||| |||||||||| ||||||||||||  |||||||         ||  |||   
3'          uag gagacu cugu auaaguaagg gaaggauuuuac  aagggaa         ag  gag  a
   guugucucu   a      a    c          -            uu       uuaaguugu  uu   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12794: 1892122-1892261 [-]
intergenic
Database links

Mature sequence mes-miR6445

Accession MIMAT0045984
Sequence

26 - 

uucauuccucuuccuaaaaugg

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).