Stem-loop sequence mdo-mir-133b

AccessionMI0040828 (change log)
DescriptionMonodelphis domestica miR-133b stem-loop
Stem-loop
   -      ca  c  a      u  g   g 
5'  gcuggu  aa gg accaag cc ucu a
    ||||||  || || |||||| || ||| c
3'  cgacca  uu cc ugguuu gg aga u
   u      ac  c  c      -  -   g 
Get sequence
Deep sequencing
1558 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 300507722-300507779 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-133b
mdo-mir-206chr2: 300498999-300499074 [+]
mdo-mir-133bchr2: 300507722-300507779 [+]
Database links

Mature sequence mdo-miR-133b-5p

Accession MIMAT0050179
Sequence

1 - 

gcuggucaaacggaaccaaguc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-133b-3p

Accession MIMAT0050180
Sequence

38 - 

uuugguccccuucaaccagcu

 - 58

Get sequence
Deep sequencing1558 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).