Stem-loop sequence ggo-mir-215

AccessionMI0003031 (change log)
DescriptionGorilla gorilla miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   aucauuca   a      ------      a a  a    -u   u          uaua 
5'         gaa ugguau      acggga a ug ccua  gaa ugacagacaa    g
           ||| ||||||      |||||| | || ||||  ||| ||||||||||    c
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucuguu    u
   ------aa   c      ucagua      a a  c    uu   u          ugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 200131702-200131811 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-215
ggo-mir-194chr1: 200132006-200132090 [-]
ggo-mir-215chr1: 200131702-200131811 [-]
Database links

Mature sequence ggo-miR-215

Accession MIMAT0002734
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Evidence by similarity; MI0000291

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).