miRBase entry: cel-let-7

Stem-loop cel-let-7


Accession
MI0000001
Description
Caenorhabditis elegans cel-let-7 precursor miRNA

Literature search
620 open access papers mention cel-let-7
(4356 sentences)

Sequence

12628634 reads, 12640.0 reads per million, 93 experiments
uacacuguggauccggUGAGGUAGUAGGUUGUAUAGUUuggaauauuaccaccggugaaCUAUGCAAUUUUCUACCUUACCggagacagaacucuucga
.....(.((..(((((((((((((.((((((((((((........(((((...))))))))))))))))).)))))))))))))..)).).........

Structure
----uacac g  ga             U            Uuggaaua     a 
         u ug  uccggUGAGGUAG AGGUUGUAUAGU        uuacc  
         | ||  ||||||||||||| ||||||||||||        ||||| c
         a ac  aggCCAUUCCAUC UUUAACGUAUCa        agugg  
agcuucuca g  ag             U            --------     c 


Annotation confidence High
Do you think this miRNA is real?
Comments
let-7 is found on chromosome X in Caenorhabditis elegans [1] and pairs to sites within the 3' untranslated region (UTR) of target mRNAs, specifying the translational repression of these mRNAs and triggering the transition to late-larval and adult stages [2].

Genome context
chrX: 14744173-14744271 [-]

Database links

Mature cel-let-7-5p

Accession MIMAT0000001
Description Caenorhabditis elegans cel-let-7-5p mature miRNA
Sequence 17 - UGAGGUAGUAGGUUGUAUAGUU - 38
Evidence experimental
cloned [1-3], Northern [1], PCR [4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature cel-let-7-3p

Accession MIMAT0015091
Description Caenorhabditis elegans cel-let-7-3p mature miRNA
Sequence 60 - CUAUGCAAUUUUCUACCUUACC - 81
Evidence experimental
CLIPseq [7]
Database links

References

  1. PubMed ID: 11679671
    An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
    "Lau NC, Lim LP, Weinstein EG, Bartel DP"
    "Science (2001) 294:858-862

  2. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  3. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  4. PubMed ID: 12769849
    Computational and experimental identification of C. elegans microRNAs
    "Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J"
    "Mol Cell (2003) 11:1253-1263

  5. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  6. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  7. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179