miRBase entry: cel-mir-40

Stem-loop cel-mir-40


Accession
MI0000011
Description
Caenorhabditis elegans cel-mir-40 precursor miRNA

Literature search
2 open access papers mention cel-mir-40
(3 sentences)

Sequence

4759052 reads, 11260.0 reads per million, 92 experiments
uccuguccgcaccucAGUGGAUGUAUGCCAUGAUGAUAagauaucagaaauccuaUCACCGGGUGUACAUCAGCUAAggugcggguacaggu
.(((((((((((((.(((.((((((((((.((.(((((.(((.......))).))))).)))))))))))).))).))))))))..))))).

Structure
u     --        c   G          A  A     a   au 
 ccugu  ccgcaccu AGU GAUGUAUGCC UG UGAUA gau  c
 |||||  |||||||| ||| |||||||||| || ||||| |||  a
 ggaca  ggcguggA UCG CUACAUGUGG GC ACUau cua  g
u     ug        A   A          -  C     c   aa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrII: 11538184-11538275 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from cel-mir-40
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-40-5p

Accession MIMAT0020307
Description Caenorhabditis elegans cel-miR-40-5p mature miRNA
Sequence 16 - AGUGGAUGUAUGCCAUGAUGAUA - 38
Evidence experimental
Illumina [7]
Database links

Mature cel-miR-40-3p

Accession MIMAT0000011
Description Caenorhabditis elegans cel-miR-40-3p mature miRNA
Sequence 56 - UCACCGGGUGUACAUCAGCUAA - 77
Evidence experimental
cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679671
    An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
    "Lau NC, Lim LP, Weinstein EG, Bartel DP"
    "Science (2001) 294:858-862

  2. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  3. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  4. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  5. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  6. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577