miRBase entry: cel-mir-86

Stem-loop cel-mir-86


Accession
MI0000057
Description
Caenorhabditis elegans cel-mir-86 precursor miRNA mir-86
Gene
family?
RF00808; mir-86

Literature search
11 open access papers mention cel-mir-86
(23 sentences)

Sequence

755420 reads, 1684.0 reads per million, 92 experiments
cguguccacgccgucUAAGUGAAUGCUUUGCCACAGUCuucgauguucugaaaugaagcCUGGGCUCAGAUUCGCUUAGGCcggaguuugacacggca
((((((.((.((((((((((((((.((..(((.(((.((((.((........)))))).))))))..))))))))))))).))).))..))))))...

Structure
---      -c  g   -           G  UU   A   U    g  guu 
   cguguc  ac ccg ucUAAGUGAAU CU  GCC CAG Cuuc au   c
   ||||||  || ||| ||||||||||| ||  ||| ||| |||| ||    
   gcacag  ug ggc GGAUUCGCUUA GA  CGG GUC gaag ua   u
acg      uu  a   C           -  CU   -   c    -  aag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrIII: 11936637-11936734 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from cel-mir-86
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-86-5p

Accession MIMAT0000059
Description Caenorhabditis elegans cel-miR-86-5p mature miRNA
Sequence 16 - UAAGUGAAUGCUUUGCCACAGUC - 38
Evidence experimental
cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature cel-miR-86-3p

Accession MIMAT0020776
Description Caenorhabditis elegans cel-miR-86-3p mature miRNA
Sequence 60 - CUGGGCUCAGAUUCGCUUAGGC - 81
Evidence experimental
Illumina [7]
Database links

References

  1. PubMed ID: 11679671
    An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
    "Lau NC, Lim LP, Weinstein EG, Bartel DP"
    "Science (2001) 294:858-862

  2. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  3. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  4. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  5. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  6. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577