Stem-loop hsa-let-7c

Accession

MI0000064

Symbol

HGNC: MIRLET7C

Description

Homo sapiens hsa-let-7c precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-let-7c is a microRNA that has been studied in relation to osteo/odontogenic markers. The mRNA expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments were conducted using TaqMan® micro-RNA assays on fetal and adult eye samples. The targeted micro-RNAs in these experiments included hsa-let-7c, among others, which showed collagen specificity [PMC3804513]. However, no correlation was observed between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405]. In summary, the expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments on fetal and adult eye samples showed collagen specificity for hsa-let-7c [PMC3804513]. However, no correlation was found between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405].

Literature search

1116 open access papers mention hsa-let-7c
(6702 sentences)

Sequence

5923990 reads, 15711 reads per million, 156 experiments

gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))

Structure

  a      uU   G   U             ua  g ua  c 
gc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
|| ||||||  ||| ||| |||||||||||||  || |  || c
cg agguuC  UUC AUC UCCAACAUGUCaa  uu a  gu  
  -      CU   G   U             --  g gg  c 

Annotation confidence High

Genome context

chr21: 16539828-16539911 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-let-7c

Disease association

hsa-let-7c is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-let-7c is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-let-7c is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-let-7c-5p

• Accession: MIMAT0000064
• Description: Homo sapiens hsa-let-7c-5p mature miRNA
• Sequence: 11 - UGAGGUAGUAGGUUGUAUGGUU - 32
• Evidence: experimental ; cloned [1-4], Northern [1], Illumina [5-6]

Mature hsa-let-7c-3p

• Accession: MIMAT0026472
• Description: Homo sapiens hsa-let-7c-3p mature miRNA
• Sequence: 56 - CUGUACAACCUUCUAGCUUUCC - 77
• Evidence: experimental ; Illumina [6]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 14573789
   Reduced accumulation of specific microRNAs in colorectal neoplasia
   "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
   "Mol Cancer Res (2003) 1:882-891


3. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


4. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


5. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


6. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45