miRBase entry: hsa-let-7d

Stem-loop hsa-let-7d


Accession
MI0000065
Symbol
HGNC: MIRLET7D
Description
Homo sapiens hsa-let-7d precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7D is a microRNA that plays a crucial role in the formation of the MiCEE complex, which is essential for proper nucleolar organization by tethering regulated genes to the perinucleolar region [PMC9455804]. This microRNA selectively associates with non-coding RNAs rather than mRNAs, as demonstrated by pull-down assays [PMC6527704]. Loss of function (LOF) studies using antagomiR probes for MIRLET7D, as well as knockdown of associated proteins EXOSC10 and EZH2, have shown that reduced MIRLET7D activity leads to increased cell migration in control human primary lung fibroblasts [PMC6527704]. Furthermore, decreased levels of MIRLET7D correlate with upregulation of its target genes and fibrosis markers, suggesting its involvement in fibrotic processes [PMC6527704]. Mutations and indels in the flanking sequence of MIRLET7D have been identified in various cancers, indicating its potential role in tumorigenesis [PMC9708458]. Additionally, alterations in MIRLET7D expression may be implicated in chromatin remodeling processes as observed in certain rat models [PMC9059753]. Chromatin immunoprecipitation (ChIP) analyses further confirm that MIRLET7D affects the chromatin state at target promoters by influencing histone modification patterns [PMC6527704].

Literature search
1090 open access papers mention hsa-let-7d
(6011 sentences)

Sequence

1103859 reads, 4366 reads per million, 145 experiments
ccuaggaAGAGGUAGUAGGUUGCAUAGUUuuagggcagggauuuugcccacaaggagguaaCUAUACGACCUGCUGCCUUUCUuagg
(((((((.((((((((((((((.((((((...((((((.....))))))..........)))))).)))))))))))))))))))))

Structure
       A              C      -------uua      g 
ccuagga GAGGUAGUAGGUUG AUAGUU          gggcag g
||||||| |||||||||||||| ||||||          |||||| a
ggauUCU UUCCGUCGUCCAGC UAUCaa          cccguu u
       -              A      uggaggaaca      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr9: 94178834-94178920 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7d
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7d is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7d-5p

Accession MIMAT0000065
Description Homo sapiens hsa-let-7d-5p mature miRNA
Sequence 8 - AGAGGUAGUAGGUUGCAUAGUU - 29
Evidence experimental
cloned [1-4], Northern [1], Illumina [5]
Database links
Predicted targets

Mature hsa-let-7d-3p

Accession MIMAT0004484
Description Homo sapiens hsa-let-7d-3p mature miRNA
Sequence 62 - CUAUACGACCUGCUGCCUUUCU - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6