MIRLET7D is a microRNA that plays a crucial role in the formation of the MiCEE complex, which is essential for proper nucleolar organization by tethering regulated genes to the perinucleolar region [PMC9455804]. This microRNA selectively associates with non-coding RNAs rather than mRNAs, as demonstrated by pull-down assays [PMC6527704]. Loss of function (LOF) studies using antagomiR probes for MIRLET7D, as well as knockdown of associated proteins EXOSC10 and EZH2, have shown that reduced MIRLET7D activity leads to increased cell migration in control human primary lung fibroblasts [PMC6527704]. Furthermore, decreased levels of MIRLET7D correlate with upregulation of its target genes and fibrosis markers, suggesting its involvement in fibrotic processes [PMC6527704]. Mutations and indels in the flanking sequence of MIRLET7D have been identified in various cancers, indicating its potential role in tumorigenesis [PMC9708458]. Additionally, alterations in MIRLET7D expression may be implicated in chromatin remodeling processes as observed in certain rat models [PMC9059753]. Chromatin immunoprecipitation (ChIP) analyses further confirm that MIRLET7D affects the chromatin state at target promoters by influencing histone modification patterns [PMC6527704].
A C -------uua g ccuagga GAGGUAGUAGGUUG AUAGUU gggcag g ||||||| |||||||||||||| |||||| |||||| a ggauUCU UUCCGUCGUCCAGC UAUCaa cccguu u - A uggaggaaca u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000065 |
Description | Homo sapiens hsa-let-7d-5p mature miRNA |
Sequence | 8 - AGAGGUAGUAGGUUGCAUAGUU - 29 |
Evidence |
experimental
cloned [1-4], Northern [1], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004484 |
Description | Homo sapiens hsa-let-7d-3p mature miRNA |
Sequence | 62 - CUAUACGACCUGCUGCCUUUCU - 83 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|