Accession
MI0000066
Symbol
HGNC:
MIRLET7E
Description
Homo sapiens
hsa-let-7e precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIRLET7E is a microRNA gene that has been identified in various studies. It is a member of the let-7 family of microRNAs and has been found to be differentially expressed in different contexts. In a study on pediatric cancers, a custom gene panel was designed to include MIRLET7E for mutation profiling [PMC7341754]. Another study identified MIRLET7E as one of the differentially expressed microRNAs [PMC4052096]. It has been shown that the promoter region of MIRLET7E can be hypermethylated, leading to decreased expression [PMC4053776]. In breast cancer cell lines, MIRLET7E was found to be epigenetically repressed by lysine-specific demethylase 5B (JARID1B) [PMC4053776]. The expression profiles of MIRLET7E were missing in an independent dataset, and its expression levels were validated along with other genes [PMC10113532]. In the context of liver disorders, it was found that MIRLET7E was down-regulated by CPV treatment, which may contribute to its therapeutic effect [PMC6957807]. Furthermore, MIRLET7E has been associated with negative regulation of the anti-inflammatory cytokine IL-10 and has been implicated in autoimmune disorders and liver fibrosis [PMC6957807]. The interaction between NEAT1 and various genes including MIRLET7E was also observed in a study [PMC9730017]. Finally, in bovine neutrophils under supplementation with quercetin during inflammation induction, an inverse relationship between MIRLET7E expression and IL6 mRNA levels was observed [PMC5422244].
Literature search
1095 open access papers mention hsa-let-7e
(6132 sentences)
(6132 sentences)
Sequence
1076185
reads,
5118
reads per million, 133 experiments
cccgggcUGAGGUAGGAGGUUGUAUAGUUgaggaggacacccaaggagaucaCUAUACGGCCUCCUAGCUUUCCccagg
((.(((..(((.((((((((((((((((.((((.(....))).......)))))))))))))))))).)))..))).))
((.(((..(((.((((((((((((((((.((((.(....))).......)))))))))))))))))).)))..))).))
Structure
c cU G U ------- a g cc ggg GAG UAGGAGGUUGUAUAGU ga gg g a || ||| ||| |||||||||||||||| || || | gg ccC UUC AUCCUCCGGCAUAUCa cu cc c c a CU G - agaggaa - a
Annotation confidence
High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].
Genome context
chr19: 51692786-51692864 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7e
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-let-7e is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-let-7e-5p
| Accession | MIMAT0000066 |
| Description | Homo sapiens hsa-let-7e-5p mature miRNA |
| Sequence | 8 - UGAGGUAGGAGGUUGUAUAGUU - 29 |
| Evidence |
experimental
cloned [1-4], Northern [1], Illumina [5] |
| Database links |
|
| Predicted targets |
|
Mature hsa-let-7e-3p
| Accession | MIMAT0004485 |
| Description | Homo sapiens hsa-let-7e-3p mature miRNA |
| Sequence | 53 - CUAUACGGCCUCCUAGCUUUCC - 74 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
References
|
