MIRLET7E is a microRNA gene included in a custom gene panel designed for pediatric cancer mutation profiling, which also targets microRNA genes for structural variation detection [PMC7341754]. It is differentially expressed in pediatric cancers and has been identified as one of the genes with altered expression [PMC4052096]. Hypermethylation of the MIRLET7E promoter region has been associated with decreased expression of its product, let-7e-3p, and its expression can be epigenetically repressed by JARID1B in breast cancer cell lines [PMC4053776]. MIRLET7E is also one of the co-key genes identified in a study on ANCA-associated glomerulonephritis, although its expression profile was not validated due to missing data [PMC10113532]. It was found to be down-regulated by CPV treatment in liver disorders, suggesting a role in the therapeutic effects against such conditions [PMC6957807]. Moreover, MIRLET7E interacts with various genetic elements including pseudogenes and other miRNAs as revealed by microarray analysis [PMC9730017]. In bovine neutrophils, increased MIRLET7E expression correlates with decreased proinflammatory cytokine mRNA levels such as IL6 and TLR4 during inflammation induced by bacterial lipopolysaccharide (LPS) [PMC5422244].
c cU G U ------- a g cc ggg GAG UAGGAGGUUGUAUAGU ga gg g a || ||| ||| |||||||||||||||| || || | gg ccC UUC AUCCUCCGGCAUAUCa cu cc c c a CU G - agaggaa - a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000066 |
Description | Homo sapiens hsa-let-7e-5p mature miRNA |
Sequence | 8 - UGAGGUAGGAGGUUGUAUAGUU - 29 |
Evidence |
experimental
cloned [1-4], Northern [1], Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004485 |
Description | Homo sapiens hsa-let-7e-3p mature miRNA |
Sequence | 53 - CUAUACGGCCUCCUAGCUUUCC - 74 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|