miRBase entry: hsa-let-7e

Stem-loop hsa-let-7e


Accession
MI0000066
Symbol
HGNC: MIRLET7E
Description
Homo sapiens hsa-let-7e precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7E is a microRNA gene included in a custom gene panel designed for pediatric cancer mutation profiling, which also targets microRNA genes for structural variation detection [PMC7341754]. It is differentially expressed in pediatric cancers and has been identified as one of the genes with altered expression [PMC4052096]. Hypermethylation of the MIRLET7E promoter region has been associated with decreased expression of its product, let-7e-3p, and its expression can be epigenetically repressed by JARID1B in breast cancer cell lines [PMC4053776]. MIRLET7E is also one of the co-key genes identified in a study on ANCA-associated glomerulonephritis, although its expression profile was not validated due to missing data [PMC10113532]. It was found to be down-regulated by CPV treatment in liver disorders, suggesting a role in the therapeutic effects against such conditions [PMC6957807]. Moreover, MIRLET7E interacts with various genetic elements including pseudogenes and other miRNAs as revealed by microarray analysis [PMC9730017]. In bovine neutrophils, increased MIRLET7E expression correlates with decreased proinflammatory cytokine mRNA levels such as IL6 and TLR4 during inflammation induced by bacterial lipopolysaccharide (LPS) [PMC5422244].

Literature search
1095 open access papers mention hsa-let-7e
(6132 sentences)

Sequence

1076185 reads, 5118 reads per million, 133 experiments
cccgggcUGAGGUAGGAGGUUGUAUAGUUgaggaggacacccaaggagaucaCUAUACGGCCUCCUAGCUUUCCccagg
((.(((..(((.((((((((((((((((.((((.(....))).......)))))))))))))))))).)))..))).))

Structure
  c   cU   G                U  -------  a g 
cc ggg  GAG UAGGAGGUUGUAUAGU ga       gg g a
|| |||  ||| |||||||||||||||| ||       || |  
gg ccC  UUC AUCCUCCGGCAUAUCa cu       cc c c
  a   CU   G                -  agaggaa  - a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr19: 51692786-51692864 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7e
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7e is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7e-5p

Accession MIMAT0000066
Description Homo sapiens hsa-let-7e-5p mature miRNA
Sequence 8 - UGAGGUAGGAGGUUGUAUAGUU - 29
Evidence experimental
cloned [1-4], Northern [1], Illumina [5]
Database links
Predicted targets

Mature hsa-let-7e-3p

Accession MIMAT0004485
Description Homo sapiens hsa-let-7e-3p mature miRNA
Sequence 53 - CUAUACGGCCUCCUAGCUUUCC - 74
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6