MIRLET7F1 is a microRNA gene that is included in a custom gene panel designed for mutation profiling of pediatric cancers [PMC7341754]. The panel includes coding exons of 366 cancer-associated genes, untranslated regions and introns of 16 genes for detecting structural variations, and specific regions for detecting TERT rearrangement and promoter/enhancer mutation [PMC7341754]. In addition, the panel includes the promoter and enhancer regions of FGFR3 and MYC, as well as 11 microRNA genes including MIRLET7F1 [PMC7341754]. In a study, MIRLET7F1 was identified as one of the candidate target genes in pediatric cancers [PMC5791735]. MIRLET7F1 interacts with HNRNPM along with other miRNAs, protein coding genes, rRNAs, lncRNAs, and pseudogenes [PMC9730017]. The SNP rs10512230 is flanked by the PTPDC1 gene along with MIRLET7A1 (Let-7a-1), MIRLET7F1 (Let-7f-1), and MIRLET7D (Let-7d) genes [PMC6202974]. These microRNA genes including MIRLET7A1, MIRLET7F1, and MIRLET7D are involved in cancer and DNA damage response pathways [PMC6202974]. The custom gene panel used targeted capture technology to analyze various genomic regions including microRNA genes like MIRLET7F1 for copy number analysis in pediatric cancers [PMC7815088].
a U --------- u ucag g GAGGUAGUAGAUUGUAUAGUUgu gggguag g |||| | ||||||||||||||||||||||| ||||||| a aguC C UUCCGUUAUCUAACAUAUCaaua ucccauu u - C gaggacuug u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000067 |
Description | Homo sapiens hsa-let-7f-5p mature miRNA |
Sequence | 7 - UGAGGUAGUAGAUUGUAUAGUU - 28 |
Evidence |
experimental
cloned [1,3-5], Northern [1], Illumina [6] |
Database links | |
Predicted targets |
Accession | MIMAT0004486 |
Description | Homo sapiens hsa-let-7f-1-3p mature miRNA |
Sequence | 63 - CUAUACAAUCUAUUGCCUUCCC - 84 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|