WARNING: This summary was generated by AI. MIRLET7F1 is a microRNA gene implicated in cancer and DNA damage response pathways, and is included in a custom gene panel designed for mutation profiling in pediatric cancers [PMC6202974]. This panel targets various genomic regions, including microRNA genes like MIRLET7F1, to identify potential mutations and structural variations relevant to cancer [PMC7341754]. MIRLET7F1, along with other microRNA genes such as MIRLET7A1 and MIRLET7D, was identified as a candidate target gene in the study, suggesting its potential role in pediatric cancer pathogenesis [PMC5791735]. Additionally, the gene interacts with heterogeneous nuclear ribonucleoprotein M (HNRNPM), which is involved with various RNA species including miRNAs like MIRLET7F1 [PMC9730017]. The SNP rs10512230 is located near the MIRLET7F1 gene, indicating that variations within this region could be relevant for studies on genetic predispositions to cancer [PMC6202974]. However, the targeted capture approach used for mutation profiling does not explicitly state that untranslated regions and introns of MIRLET7F1 are included; it specifies these regions for a different set of genes, and while it does include microRNA genes, the targeted regions for microRNA genes like MIRLET7F1 are not detailed to that extent [PMC7815088].
a U --------- u
ucag g GAGGUAGUAGAUUGUAUAGUUgu gggguag g
|||| | ||||||||||||||||||||||| ||||||| a
aguC C UUCCGUUAUCUAACAUAUCaaua ucccauu u
- C gaggacuug u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000067 |
| Description | Homo sapiens hsa-let-7f-5p mature miRNA |
| Sequence | 7 - UGAGGUAGUAGAUUGUAUAGUU - 28 |
| Evidence |
experimental
cloned [1,3-5], Northern [1], Illumina [6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004486 |
| Description | Homo sapiens hsa-let-7f-1-3p mature miRNA |
| Sequence | 63 - CUAUACAAUCUAUUGCCUUCCC - 84 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|