miRBase entry: hsa-let-7f-1

Stem-loop hsa-let-7f-1


Accession
MI0000067
Symbol
HGNC: MIRLET7F1
Description
Homo sapiens hsa-let-7f-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7F1 is a microRNA gene implicated in cancer and DNA damage response pathways, and is included in a custom gene panel designed for mutation profiling in pediatric cancers [PMC6202974]. This panel targets various genomic regions, including microRNA genes like MIRLET7F1, to identify potential mutations and structural variations relevant to cancer [PMC7341754]. MIRLET7F1, along with other microRNA genes such as MIRLET7A1 and MIRLET7D, was identified as a candidate target gene in the study, suggesting its potential role in pediatric cancer pathogenesis [PMC5791735]. Additionally, the gene interacts with heterogeneous nuclear ribonucleoprotein M (HNRNPM), which is involved with various RNA species including miRNAs like MIRLET7F1 [PMC9730017]. The SNP rs10512230 is located near the MIRLET7F1 gene, indicating that variations within this region could be relevant for studies on genetic predispositions to cancer [PMC6202974]. However, the targeted capture approach used for mutation profiling does not explicitly state that untranslated regions and introns of MIRLET7F1 are included; it specifies these regions for a different set of genes, and while it does include microRNA genes, the targeted regions for microRNA genes like MIRLET7F1 are not detailed to that extent [PMC7815088].

Literature search
1093 open access papers mention hsa-let-7f-1
(6143 sentences)

Sequence

24889185 reads, 65280 reads per million, 157 experiments
ucagagUGAGGUAGUAGAUUGUAUAGUUgugggguagugauuuuacccuguucaggagauaaCUAUACAAUCUAUUGCCUUCCCuga
((((.(.((((((((((((((((((((((((((((((.....))))))).........))))))))))))))))))))))).)))))

Structure
    a U                       ---------       u 
ucag g GAGGUAGUAGAUUGUAUAGUUgu         gggguag g
|||| | |||||||||||||||||||||||         ||||||| a
aguC C UUCCGUUAUCUAACAUAUCaaua         ucccauu u
    - C                       gaggacuug       u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 94176347-94176433 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7f-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7f-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7f-5p

Accession MIMAT0000067
Description Homo sapiens hsa-let-7f-5p mature miRNA
Sequence 7 - UGAGGUAGUAGAUUGUAUAGUU - 28
Evidence experimental
cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

Mature hsa-let-7f-1-3p

Accession MIMAT0004486
Description Homo sapiens hsa-let-7f-1-3p mature miRNA
Sequence 63 - CUAUACAAUCUAUUGCCUUCCC - 84
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6