MIRLET7F2 is a microRNA gene that is involved in a 122 kb maternal duplication of Xp11.22, along with MIR98 and HUWE1 genes [PMC9338470]. The Xp11.22 variant involving MIRLET7F2 and MIR98 genes may have potential epigenetic effects and requires further investigation [PMC9338470]. A custom gene panel was designed for mutation profiling of pediatric cancers, which includes MIRLET7F2 among 11 microRNA genes [PMC7341754]. MIRLET7F2 is expressed abundantly in lymphoid tumor cell lines [PMC9210832]. It is not targeted by several miRNAs, including members of the let-7 family such as MIRLET7A1, MIRLET7C, and MIRLET7F2, suggesting potential auto-regulation [PMC7961530]. The SureSelect custom kit was used for targeted capture in the study, which includes the detection of structural variations involving CD274, CTNNB1, ERG, ETV1, ETV4, EWSR1, FEV, FLI1 FOXO1 FUS INO80D NCOA1 NCOA2 NOTCH1 PAX3 PAX7 genes as well as promoter and enhancer regions of FGFR3 MYC TERT and microRNA genes including MIR100 to MIRLET7G [PMC7815088].
u U ---- cau guggga GAGGUAGUAGAUUGUAUAGU Uuuagggu a |||||| |||||||||||||||||||| |||||||| cacCCU UUCUGUCAUCUGACAUAUCa agguucua c g - auag ccc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000067 |
Description | Homo sapiens hsa-let-7f-5p mature miRNA |
Sequence | 8 - UGAGGUAGUAGAUUGUAUAGUU - 29 |
Evidence |
experimental
cloned [1,3-5], Northern [1], Illumina [6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004487 |
Description | Homo sapiens hsa-let-7f-2-3p mature miRNA |
Sequence | 58 - CUAUACAGUCUACUGUCUUUCC - 79 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|