miRBase entry: hsa-let-7f-2

Stem-loop hsa-let-7f-2


Accession
MI0000068
Symbol
HGNC: MIRLET7F2
Description
Homo sapiens hsa-let-7f-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7F2 is a microRNA gene located on the X chromosome, specifically within a 122 kb maternal duplication at Xp11.22, which has been suggested to have potential epigenetic effects [PMC9338470]. This gene is part of a custom gene panel designed for pediatric cancer mutation profiling, which includes various microRNA genes known to be involved in cancer biology [PMC7341754]. Notably, MIRLET7F2 is one of the abundant miRNAs secreted by lymphoid tumor cell lines, indicating its significance in the context of lymphoid tumors [PMC9210832]. Additionally, MIRLET7F2 is involved in potential auto-regulation mechanisms as it targets MIRLET7BHG along with other members of the let-7 family [PMC7961530]. The targeted capture for mutation profiling includes MIRLET7F2 among other critical genes and regions associated with cancer to facilitate comprehensive genomic analysis and understanding of its role in oncogenesis [PMC7815088].

Literature search
1093 open access papers mention hsa-let-7f-2
(6134 sentences)

Sequence

24982753 reads, 65395 reads per million, 159 experiments
ugugggaUGAGGUAGUAGAUUGUAUAGUUuuagggucauaccccaucuuggagauaaCUAUACAGUCUACUGUCUUUCCcacg
.((((((.((((((((((((((((((((((((((((........))))))))....)))))))))))))))))))))))))).

Structure
u      U                    ----        cau 
 guggga GAGGUAGUAGAUUGUAUAGU    Uuuagggu   a
 |||||| ||||||||||||||||||||    ||||||||    
 cacCCU UUCUGUCAUCUGACAUAUCa    agguucua   c
g      -                    auag        ccc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 53557192-53557274 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-let-7f-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7f-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7f-5p

Accession MIMAT0000067
Description Homo sapiens hsa-let-7f-5p mature miRNA
Sequence 8 - UGAGGUAGUAGAUUGUAUAGUU - 29
Evidence experimental
cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

Mature hsa-let-7f-2-3p

Accession MIMAT0004487
Description Homo sapiens hsa-let-7f-2-3p mature miRNA
Sequence 58 - CUAUACAGUCUACUGUCUUUCC - 79
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6