WARNING: This summary was generated by AI. MIRLET7F2 is a microRNA gene located on the X chromosome, specifically within a 122 kb maternal duplication at Xp11.22, which has been suggested to have potential epigenetic effects [PMC9338470]. This gene is part of a custom gene panel designed for pediatric cancer mutation profiling, which includes various microRNA genes known to be involved in cancer biology [PMC7341754]. Notably, MIRLET7F2 is one of the abundant miRNAs secreted by lymphoid tumor cell lines, indicating its significance in the context of lymphoid tumors [PMC9210832]. Additionally, MIRLET7F2 is involved in potential auto-regulation mechanisms as it targets MIRLET7BHG along with other members of the let-7 family [PMC7961530]. The targeted capture for mutation profiling includes MIRLET7F2 among other critical genes and regions associated with cancer to facilitate comprehensive genomic analysis and understanding of its role in oncogenesis [PMC7815088].
u U ---- cau guggga GAGGUAGUAGAUUGUAUAGU Uuuagggu a |||||| |||||||||||||||||||| |||||||| cacCCU UUCUGUCAUCUGACAUAUCa agguucua c g - auag ccc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000067 |
| Description | Homo sapiens hsa-let-7f-5p mature miRNA |
| Sequence | 8 - UGAGGUAGUAGAUUGUAUAGUU - 29 |
| Evidence |
experimental
cloned [1,3-5], Northern [1], Illumina [6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004487 |
| Description | Homo sapiens hsa-let-7f-2-3p mature miRNA |
| Sequence | 58 - CUAUACAGUCUACUGUCUUUCC - 79 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|