Stem-loop hsa-let-7f-2

Accession

MI0000068

Symbol

HGNC: MIRLET7F2

Description

Homo sapiens hsa-let-7f-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIRLET7F2 is a microRNA gene that is involved in a 122 kb maternal duplication of Xp11.22, along with MIR98 and HUWE1 genes [PMC9338470]. The Xp11.22 variant involving MIRLET7F2 and MIR98 genes may have potential epigenetic effects and requires further investigation [PMC9338470]. A custom gene panel was designed for mutation profiling of pediatric cancers, which includes MIRLET7F2 among 11 microRNA genes [PMC7341754]. MIRLET7F2 is expressed abundantly in lymphoid tumor cell lines [PMC9210832]. It is not targeted by several miRNAs, including members of the let-7 family such as MIRLET7A1, MIRLET7C, and MIRLET7F2, suggesting potential auto-regulation [PMC7961530]. The SureSelect custom kit was used for targeted capture in the study, which includes the detection of structural variations involving CD274, CTNNB1, ERG, ETV1, ETV4, EWSR1, FEV, FLI1 FOXO1 FUS INO80D NCOA1 NCOA2 NOTCH1 PAX3 PAX7 genes as well as promoter and enhancer regions of FGFR3 MYC TERT and microRNA genes including MIR100 to MIRLET7G [PMC7815088].

Literature search

1093 open access papers mention hsa-let-7f-2
(6134 sentences)

Sequence

24982758 reads, 65395 reads per million, 159 experiments

ugugggaUGAGGUAGUAGAUUGUAUAGUUuuagggucauaccccaucuuggagauaaCUAUACAGUCUACUGUCUUUCCcacg
.((((((.((((((((((((((((((((((((((((........))))))))....)))))))))))))))))))))))))).

Structure

u      U                    ----        cau 
 guggga GAGGUAGUAGAUUGUAUAGU    Uuuagggu   a
 |||||| ||||||||||||||||||||    ||||||||    
 cacCCU UUCUGUCAUCUGACAUAUCa    agguucua   c
g      -                    auag        ccc 

Annotation confidence High

Genome context

chrX: 53557192-53557274 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-let-7f-2

Disease association

hsa-let-7f-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-let-7f-5p

• Accession: MIMAT0000067
• Description: Homo sapiens hsa-let-7f-5p mature miRNA
• Sequence: 8 - UGAGGUAGUAGAUUGUAUAGUU - 29
• Evidence: experimental ; cloned [1,3-5], Northern [1], Illumina [6]

Mature hsa-let-7f-2-3p

• Accession: MIMAT0004487
• Description: Homo sapiens hsa-let-7f-2-3p mature miRNA
• Sequence: 58 - CUAUACAGUCUACUGUCUUUCC - 79
• Evidence: experimental ; cloned [4]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 14573789
   Reduced accumulation of specific microRNAs in colorectal neoplasia
   "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
   "Mol Cancer Res (2003) 1:882-891


3. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


4. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


5. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


6. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6