miRBase entry: hsa-mir-19b-1

Stem-loop hsa-mir-19b-1


Accession
MI0000074
Symbol
HGNC: MIR19B1
Description
Homo sapiens hsa-mir-19b-1 precursor miRNA mir-19
Gene
family?
RF00245; mir-19

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR19B1 is a member of the miR-17~92 cluster and has been associated with various conditions and diseases. It has been linked to the presence of right renal agenesis [PMC9090243]. Additionally, MIR19B1, along with MIR17, MIR18A, and MIR20A, is part of the miR-17–92 cluster on chromosome 13 that is upregulated in lung cancer cell lines and involved in repression of proliferation inhibition and apoptotic agents [PMC6418160]. In the context of malignancy, MIR19B1 has been found to be one of the most upregulated miRNAs [PMC9390975]. In individuals with non-syndromic CAKUT (congenital anomalies of the kidney and urinary tract), pathogenic variants in MIR19B1 have been identified [PMC7998154]. The miR-17~92 cluster genes, including MIR19B1, have been found to be encompassed by a microduplication at 13q31.3 [PMC4005632]. The host gene for the miR-17~92 cluster is MIR17HG, which encodes for six individual miRNAs including MIR19B1 [PMC4005632]. Copy gains or amplifications affecting this locus have also been found to impact the miR17-92 cluster genes [PMC9259584].

References:
[PMC9090243] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9090243/
[PMC6418160] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6418160/
[PMC9390975] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9390975/
[PMC7998154] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7998154/
[PMC4005632] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4005632/
[PMC9259584] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9259584/

Literature search
302 open access papers mention hsa-mir-19b-1
(1309 sentences)

Sequence

871328 reads, 12712 reads per million, 152 experiments
cacuguucuaugguuAGUUUUGCAGGUUUGCAUCCAGCugugugauauucugcUGUGCAAAUCCAUGCAAAACUGAcugugguagug
(((((..(((((((((((((((((((((((((..((((.............)))))))))).)).))))))))))))))))))))))

Structure
     uu                 -  -      UC    ugugu 
cacug  cuaugguuAGUUUUGCA GG UUUGCA  CAGC     g
|||||  ||||||||||||||||| || ||||||  ||||     a
gugau  ggugucAGUCAAAACGU CC AAACGU  GUcg     u
     --                 A  U      --    ucuua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr13: 91351192-91351278 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-19b-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-19b-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-19b-1 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-19b-1 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-19b-1-5p

Accession MIMAT0004491
Description Homo sapiens hsa-miR-19b-1-5p mature miRNA
Sequence 16 - AGUUUUGCAGGUUUGCAUCCAGC - 38
Evidence experimental
cloned [8]
Database links
Predicted targets

Mature hsa-miR-19b-3p

Accession MIMAT0000074
Description Homo sapiens hsa-miR-19b-3p mature miRNA
Sequence 54 - UGUGCAAAUCCAUGCAAAACUGA - 76
Evidence experimental
cloned [1-3,6-9], Northern [1,5]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  9. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854