Stem-loop hsa-mir-22

Accession

MI0000078

Symbol

HGNC: MIR22

Description

Homo sapiens hsa-mir-22 precursor miRNA mir-22

Gene
family

RF00653; mir-22

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR22 is a microRNA that has been studied in relation to various biological processes. In a study conducted on U251 and EA.hy926 cells, the knockdown of RPL29 using siRNA, followed by poly(I:C) treatment, resulted in the quantification of MIR22 using qRT-PCR [PMC7530758]. The study found that the differential expression of MIR22 can regulate inflammation induced by the transmissible gastroenteritis virus in intestinal porcine epithelial cells [PMC7530758]. Another study observed that low expression of MIR22 was associated with poor prognosis in patients with hepatocellular carcinoma [PMC9284388]. However, further research is needed to fully understand the regulatory pathways through which RPL29 influences MIR22 expression [PMC7530758]. These findings highlight the potential role of MIR22 in inflammation and disease progression and emphasize the need for further investigation to elucidate its mechanisms of action.

Literature search

294 open access papers mention hsa-mir-22
(1734 sentences)

Sequence

351813 reads, 2726 reads per million, 144 experiments

ggcugagccgcaguAGUUCUUCAGUGGCAAGCUUUAuguccugacccagcuaAAGCUGCCAGUUGAAGAACUGUugcccucugcc
(((.(((..((((((((((((((((((((.((((((.((.........))))))))))))).))))))))))))))).))).)))

Structure

   u   cc               -     A      u  ccu 
ggc gag  gcaguAGUUCUUCAG UGGCA GCUUUA gu   g
||| |||  ||||||||||||||| ||||| |||||| ||   a
ccg cuc  cguUGUCAAGAAGUU ACCGU CGAAau cg   c
   u   -c               G     -      -  acc 

Annotation confidence High

Genome context

chr17: 1713903-1713987 [-]

Disease association

hsa-mir-22 is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-22 is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-22 is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-22-5p

• Accession: MIMAT0004495
• Description: Homo sapiens hsa-miR-22-5p mature miRNA
• Sequence: 15 - AGUUCUUCAGUGGCAAGCUUUA - 36
• Evidence: experimental ; cloned [4]

Mature hsa-miR-22-3p

• Accession: MIMAT0000077
• Description: Homo sapiens hsa-miR-22-3p mature miRNA
• Sequence: 53 - AAGCUGCCAGUUGAAGAACUGU - 74
• Evidence: experimental ; cloned [1,3-5], Northern [1], Illumina [6]

References

1. PubMed ID: 11679670
   Identification of novel genes coding for small expressed RNAs
   "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
   "Science (2001) 294:853-858


2. PubMed ID: 14573789
   Reduced accumulation of specific microRNAs in colorectal neoplasia
   "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
   "Mol Cancer Res (2003) 1:882-891


3. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


4. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


5. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


6. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854