miRBase entry: hsa-mir-29a

Stem-loop hsa-mir-29a


Accession
MI0000087
Symbol
HGNC: MIR29A
Description
Homo sapiens hsa-mir-29a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29A is a microRNA that is involved in various biological processes and diseases. It is a type of non-coding RNA that regulates gene expression. One study found that MIR29A, along with miR24, is primed by myocardin and plays a role in atherosclerosis retardation and matrix remodeling and fibrosis [PMC7123062]. In patients with non-small cell lung cancer (NSCLC), MIR29A levels were significantly lower compared to patients with small cell lung cancer (SCLC) [PMC9987486]. Additionally, MIR29A was found to be differentially expressed in pancreatic ductal (PD) compared to viral pancreatitis (VP) specimens, along with miR-23a and miR181c [PMC8407885]. The expression of MIR29A was also associated with patient prognosis, where elevated expression of certain microRNAs including MIR29A was correlated with poor patient survival [PMC6368411]. In liver fibrosis, TGF-β1 was found to downregulate MIR29A, potentially inducing the expression of Fstl1 [PMC7493388]. Furthermore, MIR29A has been found to be upregulated in breast cancer stem cells (BCSCs), aggressive breast cancer cell lines, and breast cancer tissues [PMC9102147]. Finally, the importance of MIR29A during the regression of liver fibrosis has been highlighted in a study [PMC6412626]. Overall, these findings demonstrate the diverse roles of MIR29A in various diseases and biological processes.

Literature search
662 open access papers mention hsa-mir-29a
(3429 sentences)

Sequence

2370837 reads, 9609 reads per million, 141 experiments
augACUGAUUUCUUUUGGUGUUCAGagucaauauaauuuucUAGCACCAUCUGAAAUCGGUUAu
((((((((((((...(((((((.((((...........)))))))))))...))))))))))))

Structure
            UUU       C    ucaa 
augACUGAUUUC   UGGUGUU AGag    u
||||||||||||   ||||||| ||||    a
uAUUGGCUAAAG   ACCACGA Ucuu    u
            UCU       -    uuaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-29a was previously know as miR-29 here and in [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
chr7: 130876747-130876810 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29a-5p

Accession MIMAT0004503
Description Homo sapiens hsa-miR-29a-5p mature miRNA
Sequence 4 - ACUGAUUUCUUUUGGUGUUCAG - 25
Evidence experimental
cloned [6]
Database links
Predicted targets

Mature hsa-miR-29a-3p

Accession MIMAT0000086
Description Homo sapiens hsa-miR-29a-3p mature miRNA
Sequence 42 - UAGCACCAUCUGAAAUCGGUUA - 63
Evidence experimental
cloned [1-3,5-7], Northern [1,4], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6