MIR29A is a microRNA that is involved in various biological processes and diseases. It is a type of non-coding RNA that regulates gene expression. One study found that MIR29A, along with miR24, is primed by myocardin and plays a role in atherosclerosis retardation and matrix remodeling and fibrosis [PMC7123062]. In patients with non-small cell lung cancer (NSCLC), MIR29A levels were significantly lower compared to patients with small cell lung cancer (SCLC) [PMC9987486]. Additionally, MIR29A was found to be differentially expressed in pancreatic ductal (PD) compared to viral pancreatitis (VP) specimens, along with miR-23a and miR181c [PMC8407885]. The expression of MIR29A was also associated with patient prognosis, where elevated expression of certain microRNAs including MIR29A was correlated with poor patient survival [PMC6368411]. In liver fibrosis, TGF-β1 was found to downregulate MIR29A, potentially inducing the expression of Fstl1 [PMC7493388]. Furthermore, MIR29A has been found to be upregulated in breast cancer stem cells (BCSCs), aggressive breast cancer cell lines, and breast cancer tissues [PMC9102147]. Finally, the importance of MIR29A during the regression of liver fibrosis has been highlighted in a study [PMC6412626]. Overall, these findings demonstrate the diverse roles of MIR29A in various diseases and biological processes.
UUU C ucaa augACUGAUUUC UGGUGUU AGag u |||||||||||| ||||||| |||| a uAUUGGCUAAAG ACCACGA Ucuu u UCU - uuaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004503 |
Description | Homo sapiens hsa-miR-29a-5p mature miRNA |
Sequence | 4 - ACUGAUUUCUUUUGGUGUUCAG - 25 |
Evidence |
experimental
cloned [6] |
Database links | |
Predicted targets |
Accession | MIMAT0000086 |
Description | Homo sapiens hsa-miR-29a-3p mature miRNA |
Sequence | 42 - UAGCACCAUCUGAAAUCGGUUA - 63 |
Evidence |
experimental
cloned [1-3,5-7], Northern [1,4], Illumina [8] |
Database links | |
Predicted targets |
|