MIR101-1 is a microRNA-containing precursor that has been found to decrease significantly in LT and Ar compared to IBA in various brain regions [PMC7848201]. It is one of the miRNA precursors that showed the highest fold-changes in expression [PMC7848201]. MIR101-1 is also included in the top-ranked miRNA expression signatures [PMC9284388]. It has been identified as one of the differentially expressed genes (DEGs) related to Th2 cells and MAIT cells [PMC9380889]. The G-allele of rs11594111 extends the continuous complementary sequence to MIR101-1 from 7 nucleotides to 11 nucleotides [PMC3198095]. However, SUV39H2 mRNA is not predicted to be a target for MIR101-1 [PMC3198095]. In small RNA-seq datasets, MIR101-1 has uniquely aligned read pairs, while its paralogue MIR101-2 does not have any assigned read pairs [PMC6901076]. In Parkinson's disease patients, MIR101-1 has been found to be notably down-regulated along with other miRNAs such as miR-133b, miR218-2, and miR107 [PMC5288660]. References: [PMC7848201] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7848201/ [PMC9284388] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9284388/ [PMC9380889] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9380889/ [PM3198095] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM3198095/ [PM6901076] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM6901076/ [PMC5288660] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5288660/
cuggc A gucua ugcc uCAGUUAUCACAGUGCUG UGCU u |||| |||||||||||||||||| |||| acgg AGUCAAUAGUGUCAUGAC AUgg u uaggA - aaauc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004513 |
Description | Homo sapiens hsa-miR-101-5p mature miRNA |
Sequence | 11 - CAGUUAUCACAGUGCUGAUGCU - 32 |
Evidence |
experimental
cloned [3-4] |
Database links | |
Predicted targets |
Accession | MIMAT0000099 |
Description | Homo sapiens hsa-miR-101-3p mature miRNA |
Sequence | 47 - UACAGUACUGUGAUAACUGAA - 67 |
Evidence |
experimental
cloned [1-4] |
Database links | |
Predicted targets |
|