miRBase entry: dme-mir-6-2

Stem-loop dme-mir-6-2


Accession
MI0000125
Description
Drosophila melanogaster dme-mir-6-2 precursor miRNA mir-6
Gene
family?
RF00143; mir-6

Literature search
8 open access papers mention dme-mir-6-2
(33 sentences)

Sequence

18732 reads, 365 reads per million, 38 experiments
uaacccaAGGGAACUUCUGCUGCUGAUAUAuuauugaaaaacuacuaUAUCACAGUGGCUGUUCUUUUUgguug
(((((.((((((((..((((((.(((((((.((((....)).)).)))))))))))))..)))))))).)))))

Structure
     c        UU      C       u  -  g 
uaacc aAGGGAAC  CUGCUG UGAUAUA ua uu a
||||| ||||||||  |||||| ||||||| || ||  
guugg UUUUCUUG  GGUGAC ACUAUau au aa a
     U        UC      -       c  c  a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2R: 19660869-19660942 [-]
Clustered miRNAs
7 other miRNAs are < 10 kb from dme-mir-6-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-6-3p

Accession MIMAT0000111
Description Drosophila melanogaster dme-miR-6-3p mature miRNA
Sequence 48 - UAUCACAGUGGCUGUUCUUUUU - 69
Evidence experimental
cloned [1,3], Northern [1-2], 454 [4], Illumina [5]
Database links
Predicted targets

Mature dme-miR-6-2-5p

Accession MIMAT0020788
Description Drosophila melanogaster dme-miR-6-2-5p mature miRNA
Sequence 8 - AGGGAACUUCUGCUGCUGAUAUA - 30
Evidence not_experimental
Database links

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  3. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  4. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  5. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879