Stem-loop ath-MIR157c

Accession

MI0000186

Description

Arabidopsis thaliana ath-MIR157c precursor miRNA

Literature search

16 open access papers mention ath-MIR157c
(202 sentences)

Sequence

agguuugagagugauguugguugUUGACAGAAGAUAGAGAGCACuaaggaugacaugcaaguacauacauauauaucaucacaccgcauguggaugauaaaauauguauaacaaauucaaagaaagagagggagagaaagagagagaaccugcaucucuacucuuuuguGCUCUCUAUACUUCUGUCACCaccuuuaucucuucuucucucuaaccu
(((((.(((((.((((..(((.((.(((((((((((((((((((....................((((((((.(((((((.(((.....))))))))))..))))))))............(((((((..(((((...((.(......)))...))))).)))))))))))))))))).)))))))))).)))..)))).......))))).)))))

Structure

     u     ------u    uu   u  U        -           --------------------------------------uaaggaugacaugcaaguac        -a       a   c 
agguu gagag       gaug  ggu gU GACAGAAG AUAGAGAGCAC                                                          auacauau  uaucauc cac g
||||| |||||       ||||  ||| || |||||||| |||||||||||                                                          ||||||||  ||||||| ||| c
uccaa cucuc       cuau  cca CA CUGUCUUC UAUCUCUCGug                                                          uauguaua  auaguag gug a
     u     uucuucu    uu   C  -        A           uuuucucaucucuacguccaagagagagaaagagagggagagaaagaaacuuaaacaa        aa       -   u 

Annotation confidence Not enough data

Comments

MIR157c is thought, like the miR156 family, to target mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [2].

Genome context

chr3: 6244500-6244716 [-]

Mature ath-miR157c-5p

• Accession: MIMAT0000174
• Description: Arabidopsis thaliana ath-miR157c-5p mature miRNA
• Sequence: 24 - UUGACAGAAGAUAGAGAGCAC - 44
• Evidence: experimental ; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR157c-3p

• Accession: MIMAT0031872
• Description: Arabidopsis thaliana ath-miR157c-3p mature miRNA
• Sequence: 170 - GCUCUCUAUACUUCUGUCACC - 190
• Evidence: not_experimental

References

1. PubMed ID: 12101121
   MicroRNAs in plants
   "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
   "Genes Dev (2002) 16:1616-1626


2. PubMed ID: 12202040
   Prediction of plant microRNA targets
   "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
   "Cell (2002) 110:513-520


3. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


4. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


5. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


6. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177