Stem-loop ath-MIR161

Accession

MI0000193

Description

Arabidopsis thaliana ath-MIR161 precursor miRNA MIR161

Gene
family

RF04079; MIR161

Literature search

18 open access papers mention ath-MIR161
(53 sentences)

Sequence

15223326 reads, 86751.0 reads per million, 185 experiments

ugcuugaucucgguuuuugaccaguuuauugcgucgaucaaugcauUGAAAGUGACUACAUCGGGGUuccgauuuuuuuuguucuucauaugaugaagcggaaacaguaaucaacCCUGGUUUAGUCACUUUCACUgcauuaaucaaugcauuuguaaaaagagggaaaagca
(((((..((((((((...))))..((((((((((.(((.((((((.((((((((((((.(((((((((...(((.((((((..((((((...)))))))))))).)))....))))))))).)))))))))))).)))))).))).)))))...)))))..))))...)))))

Structure

     -ga    gguuuuugaccag     ---     c   c      u            C         -ccg   u      uu      a 
ugcuu   ucuc             uuuau   ugcgu gau aaugca UGAAAGUGACUA AUCGGGGUu    auu uuuuug  cuucau  
|||||   ||||             |||||   ||||| ||| |||||| |||||||||||| |||||||||    ||| ||||||  |||||| u
acgaa   ggag             aaaug   acgua cua uuacgU ACUUUCACUGAU UGGUCCcaa    uga aaaggc  gaagua  
     aag    -----------aa     uuu     a   a      C            U         cuaa   c      --      g 

Annotation confidence High

Comments

MIR161 is to target mRNAs coding for PPR repeat proteins [2].

Genome context

chr1: 17825685-17825857 [+]

Mature ath-miR161-5p

• Accession: MIMAT0006779
• Description: Arabidopsis thaliana ath-miR161-5p mature miRNA
• Sequence: 47 - UGAAAGUGACUACAUCGGGGU - 67
• Evidence: experimental ; cloned [3], PARE [6], Illumina [7]

Mature ath-miR161-3p

• Accession: MIMAT0060825
• Description: Arabidopsis thaliana ath-miR161-3p mature miRNA
• Sequence: 116 - CCUGGUUUAGUCACUUUCACU - 136
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 12101121
   MicroRNAs in plants
   "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
   "Genes Dev (2002) 16:1616-1626


2. PubMed ID: 12202040
   Prediction of plant microRNA targets
   "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
   "Cell (2002) 110:513-520


3. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


4. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


5. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


6. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


7. PubMed ID: 18542052
   Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends
   "German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ"
   "Nat Biotechnol (2008) 26:941-946