miRBase entry: ath-MIR166b

Stem-loop ath-MIR166b


Accession
MI0000202
Description
Arabidopsis thaliana ath-MIR166b precursor miRNA

Literature search
41 open access papers mention ath-MIR166b
(307 sentences)

Sequence

38947781 reads, 117380.0 reads per million, 185 experiments
uugaggGGACUGUUGUCUGGCUCGAGGAcucuuauucuaauacaaucucauuugaauacauucagaucugaugauugauuaggguuuuagugucgUCGGACCAGGCUUCAUUCCCCccaa
.((.(((((.((..((((((.((((.(((.((.((((((((.((((((((((((((....))))))..))).)))))))))))))...)).))).)))).))))))..)).))))).)).

Structure
u  a     C  UU      C    G   u  --u        a     -   --      u 
 ug ggGGA UG  GUCUGG UCGA GAc cu   auucuaau caauc uca  uuugaa a
 || ||||| ||  |||||| |||| ||| ||   |||||||| ||||| |||  ||||||  
 ac CCCCU AC  CGGACC GGCU cug ga   ugggauua guuag agu  agacuu c
a  c     U  UU      A    g   u  uuu        -     u   cu      a 


Annotation confidence High
Do you think this miRNA is real?
Comments
MIR166b, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
chr3: 22922206-22922325 [+]

Database links

Mature ath-miR166b-5p

Accession MIMAT0031881
Description Arabidopsis thaliana ath-miR166b-5p mature miRNA
Sequence 7 - GGACUGUUGUCUGGCUCGAGGA - 28
Evidence experimental
Illumina [7]

Mature ath-miR166b-3p

Accession MIMAT0000190
Description Arabidopsis thaliana ath-miR166b-3p mature miRNA
Sequence 96 - UCGGACCAGGCUUCAUUCCCC - 116
Evidence experimental
cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  7. PubMed ID: 24119003
    Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots
    Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutiérrez RA
    BMC Genomics (2013) 14:701