Stem-loop ath-MIR172a

Accession

MI0000215

Description

Arabidopsis thaliana ath-MIR172a precursor miRNA

Literature search

57 open access papers mention ath-MIR172a
(367 sentences)

Sequence

ugcuguggcaucaucaagauucacaucuguugauggacgguggugauucacucuccacaaaguucucuaugaaaaugAGAAUCUUGAUGAUGCUGCAUcggc
((.(((((((((((((((((((.(((...(((.((((.(((((....))))).)))))))..(((.....))).))).))))))))))))))))))).))..

Structure

--  c                   a   -----------cug   a    c     u 
  ug uguggcaucaucaagauuc cau              uug ugga ggugg g
  || ||||||||||||||||||| |||              ||| |||| |||||  
  gc ACGUCGUAGUAGUUCUAAG gua              aac accu ucacu a
cg  U                   A   aaaguaucucuuga   -    c     u 

Annotation confidence Not enough data

Comments

This sequence was independently identified by two groups. Park et al. described miR172a1, found on chromosome 2 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a2 (MIR:MI0000216) [1]. These sequences have been renamed miR172a and miR172b here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123a [2], and was previously identified as MIR180a here. This sequence is not related to mouse miR-123.

Genome context

chr2: 11942914-11943015 [-]

Mature ath-miR172a

• Accession: MIMAT0000203
• Description: Arabidopsis thaliana ath-miR172a mature miRNA
• Sequence: 78 - AGAAUCUUGAUGAUGCUGCAU - 98
• Evidence: experimental ; cloned [1-2], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 12226481
   Short RNAs can identify new candidate transposable element families in Arabidopsis
   "Mette MF, van der Winden J, Matzke M, Matzke AJ"
   "Plant Physiol (2002) 130:6-9


6. PubMed ID: 12225663
   CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana
   "Park W, Li J, Song R, Messing J, Chen X"
   "Curr Biol (2002) 12:1484-1495