miRBase entry: ath-MIR172b

Stem-loop ath-MIR172b


Accession
MI0000216
Description
Arabidopsis thaliana ath-MIR172b precursor miRNA

Literature search
61 open access papers mention ath-MIR172b
(314 sentences)

Sequence

531981 reads, 3175.0 reads per million, 185 experiments
aggcGCAGCACCAUUAAGAUUCACAuggaaauugauaaauacccuaaauuaggguuuugauauguauaugAGAAUCUUGAUGAUGCUGCAUcaac
.((.((((((.(((((((((((.((((.....((.((((.((((((...)))))))))).))....)))).))))))))))).)))))).))...

Structure
--a  c      C           A    gaaau  a    u      a 
   gg GCAGCA CAUUAAGAUUC CAug     ug uaaa acccua  
   || |||||| ||||||||||| ||||     || |||| |||||| a
   cU CGUCGU GUAGUUCUAAG guau     au guuu ugggau  
caa  A      A           A    -augu  a    -      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was independently identified by two groups. Park et al. described miR172a2, found on chromosome 5 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a1 (MIR:MI0000215) [1]. These sequences have been renamed miR172b and miR172a here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123b [2], and was previously identified as MIR180b here. This sequence is not related to mouse miR-123. Wang et al. [2] report Northern blot evidence for the miR172b* sequence from the opposite arm of the precursor.

Genome context
chr5: 1188207-1188301 [-]

Database links

Mature ath-miR172b-5p

Accession MIMAT0000204
Description Arabidopsis thaliana ath-miR172b-5p mature miRNA
Sequence 5 - GCAGCACCAUUAAGAUUCACA - 25
Evidence experimental
Northern [3], 454 [6]

Mature ath-miR172b-3p

Accession MIMAT0000205
Description Arabidopsis thaliana ath-miR172b-3p mature miRNA
Sequence 71 - AGAAUCUUGAUGAUGCUGCAU - 91
Evidence experimental
cloned [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 12226481
    Short RNAs can identify new candidate transposable element families in Arabidopsis
    "Mette MF, van der Winden J, Matzke M, Matzke AJ"
    "Plant Physiol (2002) 130:6-9

  6. PubMed ID: 12225663
    CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana
    "Park W, Li J, Song R, Messing J, Chen X"
    "Curr Biol (2002) 12:1484-1495

  7. PubMed ID: 15345049
    Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
    Wang XJ, Reyes JL, Chua NH, Gaasterland T
    Genome Biol (2004) 5:R65