Accession
MI0000216
Description
Arabidopsis thaliana
ath-MIR172b precursor miRNA
Literature search
57 open access papers mention ath-MIR172b
(311 sentences)
(311 sentences)
Sequence
aggcGCAGCACCAUUAAGAUUCACauggaaauugauaaauacccuaaauuaggguuuugauauguauaugAGAAUCUUGAUGAUGCUGCAUcaac
.((.((((((.(((((((((((.((((.....((.((((.((((((...)))))))))).))....)))).))))))))))).)))))).))...
.((.((((((.(((((((((((.((((.....((.((((.((((((...)))))))))).))....)))).))))))))))).)))))).))...
Structure
--a c C A gaaau a u a gg GCAGCA CAUUAAGAUUC Caug ug uaaa acccua || |||||| ||||||||||| |||| || |||| |||||| a cU CGUCGU GUAGUUCUAAG guau au guuu ugggau caa A A A -augu a - u
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
This sequence was independently identified by two groups. Park et al. described miR172a2, found on chromosome 5 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a1 (MIR:MI0000215) [1]. These sequences have been renamed miR172b and miR172a here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123b [2], and was previously identified as MIR180b here. This sequence is not related to mouse miR-123. Wang et al. [2] report Northern blot evidence for the miR172b* sequence from the opposite arm of the precursor.
Genome context
chr5: 1188207-1188301 [-]
Database links
Mature ath-miR172b-5p
| Accession | MIMAT0000204 |
| Description | Arabidopsis thaliana ath-miR172b-5p mature miRNA |
| Sequence | 5 - GCAGCACCAUUAAGAUUCAC - 24 |
| Evidence |
experimental
Northern [3], 454 [6] |
Mature ath-miR172b-3p
| Accession | MIMAT0000205 |
| Description | Arabidopsis thaliana ath-miR172b-3p mature miRNA |
| Sequence | 71 - AGAAUCUUGAUGAUGCUGCAU - 91 |
| Evidence |
experimental
cloned [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7] |
References
|
