MIR192 is a specific miRNA that has been found to be increased in the renal cortex of diabetic mice compared to control mice [PMC5376412]. It is also considered a biomarker for heart failure, along with miR34a and miR-194, and is released by exosomes [PMC8773242]. These specific miRNAs, including MIR192, are being studied for their potential use in the early diagnosis of hypertrophic cardiomyopathy and heart failure [PMC8773242]. Exosomes are small vesicles that are released by cells and contain various biomolecules, including miRNAs [PMC8773242]. The levels of TGF-β1, p53, and MIR192 were found to be increased in the renal cortex of diabetic mice compared to control mice in a study [PMC5376412]. These findings suggest that MIR192 may play a role in the pathogenesis of diabetes-related renal complications. Additionally, the release of MIR192 by exosomes suggests its potential as a biomarker for heart failure. Further research is needed to fully understand the role of MIR192 in these conditions and its potential as a diagnostic tool.
gccgagacc u -- g g C - A ugcucuc gag gc aca g cu UGACCUAUG AAUUG CAGCCag g ||| || ||| | || ||||||||| ||||| ||||||| cuc cg ugu u GA ACUGGAUAC UUAAC GUCgguc u cgaccguaa - cu a g C C C uccccuc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000222 |
Description | Homo sapiens hsa-miR-192-5p mature miRNA |
Sequence | 24 - CUGACCUAUGAAUUGACAGCC - 44 |
Evidence |
experimental
cloned [3-4] |
Database links | |
Predicted targets |
Accession | MIMAT0004543 |
Description | Homo sapiens hsa-miR-192-3p mature miRNA |
Sequence | 67 - CUGCCAAUUCCAUAGGUCACAG - 88 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|