miRBase entry: hsa-mir-192

Stem-loop hsa-mir-192


Accession
MI0000234
Symbol
HGNC: MIR192
Description
Homo sapiens hsa-mir-192 precursor miRNA mir-192
Gene
family?
RF00130; mir-192

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR192 is a microRNA that has been implicated in a variety of pathological conditions, including diabetes and heart failure [PMC5376412, PMC8773242].'>PMC8773242].. Research involving diabetic mice has shown that MIR192 levels are elevated in the renal cortex, which suggests a role in the development of diabetic nephropathy [PMC5376412]. MIR192 is also being considered as a potential biomarker for heart failure, as it is found in exosomes that could be used for early detection of the disease [PMC8773242]. The recurrent observation of increased MIR192 levels in these conditions underscores its potential importance as a biomarker and as a target for therapeutic intervention [PMC5376412, PMC8773242]..

Literature search
214 open access papers mention hsa-mir-192
(1094 sentences)

Sequence

856565 reads, 864 reads per million, 125 experiments
gccgagaccgagugcacagggcuCUGACCUAUGAAUUGACAGCCagugcucucgucuccccucuggCUGCCAAUUCCAUAGGUCACAGguauguucgccucaaugccagc
.........(((.(((((.(.((.((((((((((((((.(((((((................))))))).))))).))))))))).)).).)))..))))).........

Structure
gccgagacc   u  --   g g  C         -     A       ugcucuc 
         gag gc  aca g cu UGACCUAUG AAUUG CAGCCag       g
         ||| ||  ||| | || ||||||||| ||||| |||||||        
         cuc cg  ugu u GA ACUGGAUAC UUAAC GUCgguc       u
cgaccguaa   -  cu   a g  C         C     C       uccccuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11.

Genome context
chr11: 64891137-64891246 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-192
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-192 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-192-5p

Accession MIMAT0000222
Description Homo sapiens hsa-miR-192-5p mature miRNA
Sequence 24 - CUGACCUAUGAAUUGACAGCC - 44
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-192-3p

Accession MIMAT0004543
Description Homo sapiens hsa-miR-192-3p mature miRNA
Sequence 67 - CUGCCAAUUCCAUAGGUCACAG - 88
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179