WARNING: This summary was generated by AI. MIR7-1 is a microRNA precursor located within the last intron of the HNRNPK gene on chromosome 9, which is a key player in the regulation of various metabolic traits and is believed to be the most highly expressed source of mature miR-7 [PMC9522793; PMC4600152].'>PMC4600152].. The expression of MIR7-1 is driven by HNRNPK's promoter, and it is subject to regulation by several transcription factors, including c-Myc, which directly stimulates MIR7-1 promoter activity [PMC9522793; PMC4600152].. Additionally, RELA has been confirmed to bind directly to the MIR7-1 promoter region [PMC4600152]. The transcription factor FOXP3 also positively regulates miR-7 expression in breast cancer [PMC4600152]. In contrast, QKI proteins have been shown to inhibit miR-7 biogenesis from MIR7-1 and bind intronic RNA sites near its locus affecting cancer progression [PMC7918072; PMC5693031].. Moreover, genetic variations near MIR7-1 have been implicated in gene regulation within brain regions such as the frontal cortex and hippocampus [PMC6071032]. Lastly, alterations in MIR7-1 expression have been associated with diseases including neurodegenerative disorders and various cancers as well as with environmental factors such as tobacco exposure during pregnancy affecting foetal development [PMC9571148].
--u u - a u A A U -- a ugga gu uggccu gu cugugUGG AGACU GUGAUUU GUUGUU uuuag u |||| || |||||| || |||||||| ||||| ||||||| |||||| ||||| aucu cg accgga ca gguAUACC UCUGA CACUAAA CAACag aaauc a gac c u - c G - - cu a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000252 |
| Description | Homo sapiens hsa-miR-7-5p mature miRNA |
| Sequence | 24 - UGGAAGACUAGUGAUUUUGUUGUU - 47 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004553 |
| Description | Homo sapiens hsa-miR-7-1-3p mature miRNA |
| Sequence | 66 - CAACAAAUCACAGUCUGCCAUA - 87 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|