miRBase entry: hsa-mir-7-1

Stem-loop hsa-mir-7-1


Accession
MI0000263
Symbol
HGNC: MIR7-1
Description
Homo sapiens hsa-mir-7-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR7-1 is a microRNA precursor located within the last intron of the HNRNPK gene on chromosome 9, which is a key player in the regulation of various metabolic traits and is believed to be the most highly expressed source of mature miR-7 [PMC9522793; PMC4600152].'>PMC4600152].. The expression of MIR7-1 is driven by HNRNPK's promoter, and it is subject to regulation by several transcription factors, including c-Myc, which directly stimulates MIR7-1 promoter activity [PMC9522793; PMC4600152].. Additionally, RELA has been confirmed to bind directly to the MIR7-1 promoter region [PMC4600152]. The transcription factor FOXP3 also positively regulates miR-7 expression in breast cancer [PMC4600152]. In contrast, QKI proteins have been shown to inhibit miR-7 biogenesis from MIR7-1 and bind intronic RNA sites near its locus affecting cancer progression [PMC7918072; PMC5693031].. Moreover, genetic variations near MIR7-1 have been implicated in gene regulation within brain regions such as the frontal cortex and hippocampus [PMC6071032]. Lastly, alterations in MIR7-1 expression have been associated with diseases including neurodegenerative disorders and various cancers as well as with environmental factors such as tobacco exposure during pregnancy affecting foetal development [PMC9571148].

Literature search
375 open access papers mention hsa-mir-7-1
(2111 sentences)

Sequence

2156081 reads, 4076.0 reads per million, 193 experiments
uuggauguuggccuaguucugugUGGAAGACUAGUGAUUUUGUUGUUuuuagauaacuaaaucgaCAACAAAUCACAGUCUGCCAUAuggcacaggccaugccucuacag
.((((.((((((((.((.((((((((.(((((.(((((((.(((((((((((....)))))..)))))))))))))))))).)))))))).)))))))).)).))))...

Structure
--u    u  -      a  u        A     A       U      --     a 
   ugga gu uggccu gu cugugUGG AGACU GUGAUUU GUUGUU  uuuag u
   |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
   aucu cg accgga ca gguAUACC UCUGA CACUAAA CAACag  aaauc a
gac    c  u      -  c        G     -       -      cu     a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr9: 83969748-83969857 [-]

Disease association
hsa-mir-7-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-7-5p

Accession MIMAT0000252
Description Homo sapiens hsa-miR-7-5p mature miRNA
Sequence 24 - UGGAAGACUAGUGAUUUUGUUGUU - 47
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-7-1-3p

Accession MIMAT0004553
Description Homo sapiens hsa-miR-7-1-3p mature miRNA
Sequence 66 - CAACAAAUCACAGUCUGCCAUA - 87
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540