MIR7-2 is a genomic locus that has been reported to have a functional role in hepatic lipid homeostasis and is involved in peroxisome proliferator-activated receptor regulation [PMC6591351]. It is one of the candidate genes, along with MIR6672, MIR1720, MIR3529, MIR1571, MIR1560, MIR1785, MIR6662, MIR7454, MIR10A, MIR6663, MIR1735, and MIR6547 [PMC6591351]. In humans, the miR-7-encoding genes (MIR7-1, MIR7-2, and MIR7-3) produce primary miRNAs that are processed into pre-miRNAs and finally into the same mature miR-7 [PMC6479198]. The mouse gene equivalent to human's MIR7-2 was aligned against the human reference genome (GRCh38) using BLAT and BLASTN tools in the Ensembl database [PMC6479198]. The sequence of the mouse gene was found in the intergenic region on chromosome 15 [PMC8004586]. qRT-PCR analysis has validated mature miR-7 as a peroxisome proliferator-activated receptor-alpha (PPAR-alpha)-regulated miRNA in humans derived from three separate loci in the genome (MIR7-1, MIR7-2, and MIR7-3) [PMC5762714]. Transcription factors such as Forkhead box P3 (FOXP3), RELA (v-rel avian reticuloendotheliosis viral oncogene homolog A), homeobox D10 (HOXD10), and Hepatocyte Nuclear Factor 4 alpha (HNF4α) have been found to regulate miR-7 expression by interacting with promoter regions of different miR-7 genes [PMC7918072'>PMC4600152][PMC7918072[PMC7918072]. The transcription of MIR7-1 may be activated by c-Myc [PMC7918072]. MIR7-1, MIR7-2, and MIR7-3 are encoded by genes located on chromosomes 9q21, 15q26, and 19q13, respectively [PMC7918072]. The regulation of transcription for each locus proceeds separately [PMC7918072].
cuggauacaga acc c cU A A U U ucuua gugg ggcuggc ccau GG AGACU G GAUUU GUUGUUg c |||| ||||||| |||| || ||||| | ||||| ||||||| cgcu ccgaccg gguA CC UCUGA C CUAAA CAACaac u ----------a --a u AU A C - - ucgcg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000252 |
Description | Homo sapiens hsa-miR-7-5p mature miRNA |
Sequence | 32 - UGGAAGACUAGUGAUUUUGUUGUU - 55 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004554 |
Description | Homo sapiens hsa-miR-7-2-3p mature miRNA |
Sequence | 72 - CAACAAAUCCCAGUCUACCUAA - 93 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|