miRBase entry: hsa-mir-7-2

Stem-loop hsa-mir-7-2


Accession
MI0000264
Symbol
HGNC: MIR7-2
Description
Homo sapiens hsa-mir-7-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR7-2 is a microRNA gene implicated in the regulation of lipid metabolism in the liver, specifically through its interaction with peroxisome proliferator-activated receptor (PPAR) [PMC6591351]. It is one of the fifteen microRNA candidate genes identified, and like its human counterparts MIR7-1 and MIR7-3, it contributes to the production of mature miR-7 [PMC6479198]. The gene is located in an intergenic region on chromosome 15 [PMC8004586], and its expression is regulated by PPAR-α, as evidenced by qRT-PCR analysis [PMC5762714]. Additionally, transcription factors such as Forkhead box P3 (FOXP3) and Hepatocyte Nuclear Factor 4 alpha (HNF4α) have been shown to positively regulate miR-7 expression by binding to MIR7 promoter regions [PMC4600152]'>PMC4600152], with RELA also identified as a direct binding factor to MIR7 promoter regions [PMC4600152]. The transcriptional regulation of miR-7 involves separate loci for each gene encoding it—MIR7-1 on chromosome 9q21, MIR7-2 on chromosome 15q26, and MIR7-3 on chromosome 19q13—highlighting the complexity of its regulatory mechanisms [PMC7918072].

Literature search
353 open access papers mention hsa-mir-7-2
(2068 sentences)

Sequence

1405835 reads, 2357.0 reads per million, 165 experiments
cuggauacagaguggaccggcuggccccaucUGGAAGACUAGUGAUUUUGUUGUUgucuuacugcgcucaaCAACAAAUCCCAGUCUACCUAAuggugccagccaucgca
(((....))).((((...(((((((.((((..((.(((((.(.(((((.(((((((............))))))))))))).))))).))..)))).))))))).)))).

Structure
cuggauacaga    acc       c    cU  A     A U     U       ucuua 
           gugg   ggcuggc ccau  GG AGACU G GAUUU GUUGUUg     c
           ||||   ||||||| ||||  || ||||| | ||||| |||||||      
           cgcu   ccgaccg gguA  CC UCUGA C CUAAA CAACaac     u
----------a    --a       u    AU  A     C -     -       ucgcg 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr15: 88611825-88611934 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-7-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-7-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-7-5p

Accession MIMAT0000252
Description Homo sapiens hsa-miR-7-5p mature miRNA
Sequence 32 - UGGAAGACUAGUGAUUUUGUUGUU - 55
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-7-2-3p

Accession MIMAT0004554
Description Homo sapiens hsa-miR-7-2-3p mature miRNA
Sequence 72 - CAACAAAUCCCAGUCUACCUAA - 93
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540