miRBase entry: hsa-mir-7-3

Stem-loop hsa-mir-7-3


Accession
MI0000265
Symbol
HGNC: MIR7-3
Description
Homo sapiens hsa-mir-7-3 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR7-3 is one of the three genes encoding the mature miR-7 microRNA, which is involved in the regulation of gene expression, and is located in the intron of the PGSF1 gene on chromosome 19, not the PIT1-encoding gene [PMC7918072]. This gene, along with MIR7-1 and MIR7-2, contributes to miR-7 expression, with each locus being transcribed separately [PMC7918072]. MIR7-3 was selected for mutation screening in patients with normosmic congenital hypogonadotropic hypogonadism (ncHH) based on literature and bioinformatic analyses [PMC6479198]. However, no mutations were found in MIR7-3 among these patients, suggesting that it may not be commonly mutated in ncHH and that its encoded miRNA may not be implicated in this condition [PMC6479198]. The majority of miR-7 expression in the human pituitary is presumed to come from MIR7-3 due to its location within an intron of PGSF1 (pituitary gland specific factor 1) [PMC6479198]. Despite being widely expressed at low levels throughout various brain regions including the pituitary gland, it appears that mutations within this specific microRNA gene are not a common cause for ncHH [PMC4600152].

Literature search
345 open access papers mention hsa-mir-7-3
(2053 sentences)

Sequence

1580260 reads, 3003.0 reads per million, 163 experiments
agauuagaguggcuguggucuagugcugugUGGAAGACUAGUGAUUUUGUUGUUcugauguacuacgaCAACAAGUCACAGCCGGCCUCAUagcgcagacucccuucgac
......(((.((....(((((.((((((((.((..(.((.(((((((.((((((.((......)).))))))))))))))).)..)).))))))))))))))).)))...

Structure
agauua   u  cugu     a        U  AA A  A       U      c  au 
      gag gg    ggucu gugcugug GG  G CU GUGAUUU GUUGUU ug  g
      ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
      cuu cc    ucaga cgcgaUAC CC  C GA CACUGAA CAACag au  u
---cag   c  ----     -        U  GG C  -       -      c  ca 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression in human was later verified by cloning [1,2].

Genome context
chr19: 4770670-4770779 [+]

Disease association
hsa-mir-7-3 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-7-5p

Accession MIMAT0000252
Description Homo sapiens hsa-miR-7-5p mature miRNA
Sequence 31 - UGGAAGACUAGUGAUUUUGUUGUU - 54
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-7-3-3p

Accession MIMAT0050493
Description Homo sapiens hsa-miR-7-3-3p mature miRNA
Sequence 69 - CAACAAGUCACAGCCGGCCUCAU - 91
Evidence experimental
cloned [2-3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540