Stem-loop hsa-mir-7-3

Accession

MI0000265

Symbol

HGNC: MIR7-3

Description

Homo sapiens hsa-mir-7-3 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR7-3 is a gene that encodes a mature miRNA called miR-7 [PMC7918072]. It is one of the three genes, along with MIR7-1 and MIR7-2, that produce mature miR-7 [PMC7918072]. MIR7-3 is located on chromosome 19q13 [PMC7918072]. In a study screening for mutations in miRNA genes related to the hypothalamus-pituitary-gonadal system, no mutations were found in MIR7-3 in patients with normosmic congenital hypogonadotropic hypogonadism (ncHH) [PMC6479198]. The expression of miR-7 in the human pituitary is mainly attributed to MIR7-3, which is located within the intron of the pituitary-specific gene PGSF1 (also known as MIR7-3HG) [PMC6479198] [PMC4600152]. The expression of miR-7 derives from three separate loci in the human genome: MIR7-1, MIR7-2, and MIR 73] [PMC6479198] [PMC4600152]. In humans, mature miR- 73] expression levels are enriched in various regions of the brain, particularly the pituitary gland [PMC4600152].

Literature search

335 open access papers mention hsa-mir-7-3
(2059 sentences)

Sequence

948403 reads, 6734 reads per million, 159 experiments

agauuagaguggcuguggucuagugcugugUGGAAGACUAGUGAUUUUGUUGUUcugauguacuacgacaacaagucacagccggccucauagcgcagacucccuucgac
......(((.((....(((((.((((((((.((..(.((.(((((((.((((((.((......)).))))))))))))))).)..)).))))))))))))))).)))...

Structure

agauua   u  cugu     a        U  AA A  A       U      c  au 
      gag gg    ggucu gugcugug GG  G CU GUGAUUU GUUGUU ug  g
      ||| ||    ||||| |||||||| ||  | || ||||||| |||||| ||   
      cuu cc    ucaga cgcgauac cc  c ga cacugaa caacag au  u
---cag   c  ----     -        u  gg c  -       -      c  ca 

Annotation confidence Not enough data

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression in human was later verified by cloning [1,2].

Genome context

chr19: 4770670-4770779 [+]

Disease association

hsa-mir-7-3 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-7-5p

• Accession: MIMAT0000252
• Description: Homo sapiens hsa-miR-7-5p mature miRNA
• Sequence: 31 - UGGAAGACUAGUGAUUUUGUUGUU - 54
• Evidence: experimental ; cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540