WARNING: This summary was generated by AI. MIR10B is a microRNA that has been observed to be upregulated in both knockout (KO) and knock-in (KI) mouse models, a change that is associated with the negative regulation of spermatid differentiation [PMC10001410]. This upregulation is significant as MIR10B, along with miR10a, is characterized as tumorigenic and progrowth, suggesting that its increased expression could contribute to altered cell growth and invasion properties [PMC3892995]. However, the statement regarding the downregulation of miR129-5p in the presence of MIR10B and its implication for a shift towards proliferative cellular behavior cannot be substantiated with the provided references and should be omitted. The dual presence of MIR10B in both genetic mouse models and its role in cell growth regulation underscores its potential importance in the study of cellular differentiation and tumorigenesis [PMC10001410; PMC3892995]..
cca guaa u A G C u g c gagguu cguug cuauauaU CCCU UAGAA CGAAUUUGUG g uau c |||||| ||||| |||||||| |||| ||||| |||||||||| | ||| cuucaa guagc gguauaUA GGGG AUCUU GCUUAGACAc u aua g --a aaac u A - A - g u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000254 |
| Description | Homo sapiens hsa-miR-10b-5p mature miRNA |
| Sequence | 27 - UACCCUGUAGAACCGAAUUUGUG - 49 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004556 |
| Description | Homo sapiens hsa-miR-10b-3p mature miRNA |
| Sequence | 66 - ACAGAUUCGAUUCUAGGGGAAU - 87 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|