MIR181A2 is a microRNA that can be transcribed from two different genes, MIR181A1 and MIR181A2, and is regulated by multiple transcription factors and enhancer/promoter regions [PMC8979821]. Overexpression of MIR181A2 has been associated with various types of cancer [PMC6781644]. In a hyperglycemic state, the lncRNA MIR181A2 is downregulated, leading to an increase in the concentration of certain microRNAs [PMC9430013]. Overexpression of MIR181A2 has been shown to downregulate PCAF mRNA and protein levels [PMC5573355]. The downregulation of MIR181A2 by HIV vEnv glycoprotein is associated with enhanced viral transcription and infectivity [PMC5573355]. Lentiviral particles expressing MIR181A2 have been used to transduce T cells, resulting in reduced HIV transcription [PMC5573355]. The downregulation of MIR181A2 may be a natural host mechanism targeted by HIV to activate viral transcription [PMC5573355]. The host gene for MIR181A2, known as MIR181A2HG, has been found to be overexpressed in the thyroid but its function remains unknown [PMC6380385]. The expression levels of AKT2 have been investigated as potential targets for miR-181-3p and miR-181-5p derived from the host gene MIR18IAHG [PMC7891834]. In various tissues, including the human body's nucleus, the host gene for MIRA18IAHG is expressed [PMC10111190]. In different studies, miR-18IAHG has shown potential as a biomarker for certain diseases such as diabetes and cancer but its function remains unclear in these contexts.
agaagggcuaucaggccagccuuca A U CU A ggga gaggacuccaagg ACA UCAACG GUCGGUG GUuu u ||||||||||||| ||| |||||| ||||||| |||| u uuccugggguuCC UGU AGUUGC CAGUCAC CAaa u ------------------------a A C -- - aaag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000256 |
Description | Homo sapiens hsa-miR-181a-5p mature miRNA |
Sequence | 39 - AACAUUCAACGCUGUCGGUGAGU - 61 |
Evidence |
experimental
cloned [2,4-6] |
Database links | |
Predicted targets |
Accession | MIMAT0004558 |
Description | Homo sapiens hsa-miR-181a-2-3p mature miRNA |
Sequence | 77 - ACCACUGACCGUUGACUGUACC - 98 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|