miRBase entry: hsa-mir-181b-1

Stem-loop hsa-mir-181b-1


Accession
MI0000270
Symbol
HGNC: MIR181B1
Description
Homo sapiens hsa-mir-181b-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR181B1 is a microRNA implicated in various biological processes and diseases, including carcinogenesis and psychiatric disorders [PMC8430834]. It is a critical regulator in KRAS-driven carcinogenesis, particularly in lung cancer (LC) and pancreatic ductal adenocarcinoma (PDAC) [PMC8430834]. MIR181B1 expression is modulated during differentiation, with its suppression observed upon differentiation [PMC4168020]. It has been associated with the onset of manic symptoms in bipolar disorder (BD) and is differentially expressed in schizophrenia patients on antipsychotic medication [PMC6504680]. MIR181B1 expression increases during manic episodes of BD and shows higher expression levels in treatment-resistant schizophrenia patients compared to responsive patients [PMC6504680], [PMC9554663]. However, the statement that MIR181B1 gene expression alterations are linked to regions frequently altered in cancer should be revised, as the reference does not explicitly support this claim for MIR181B1 specifically [PMC7675850], [PMC2683874]. Lastly, the Mir181ab1 cluster, which includes MIR181B1, is necessary for the induction of tumorigenesis by mutant KRAS by regulating cell cycle progression, suggesting a nonredundant function for MIR181B1 alongside miR181a1 in promoting an oncogenic phenotype [PMC7108928].

Literature search
372 open access papers mention hsa-mir-181b-1
(1614 sentences)

Sequence

452987 reads, 784 reads per million, 142 experiments
ccugugcagagauuauuuuuuaaaaggucacaaucAACAUUCAUUGCUGUCGGUGGGUugaacuguguggacaagCUCACUGAACAAUGAAUGCAAcuguggccccgcuu
.........................(((((((.....(((((((((...((((((((((....(((....))))))))))))).)))))))))....)))))))......

Structure
ccugugcagagauuauuuuuuaaaa       aucAA         CUG          gaac   g 
                         ggucaca     CAUUCAUUG   UCGGUGGGUu    ugu u
                         |||||||     |||||||||   ||||||||||    |||  
                         ccggugu     GUAAGUAAC   AGUCACUCga    aca g
-------------------uucgcc       -cAAC         --A          ----   g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MIR:MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MIR:MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr1: 198858873-198858982 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181b-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181b-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181b-5p

Accession MIMAT0000257
Description Homo sapiens hsa-miR-181b-5p mature miRNA
Sequence 36 - AACAUUCAUUGCUGUCGGUGGGU - 58
Evidence experimental
cloned [3-5]
Database links
Predicted targets

Mature hsa-miR-181b-3p

Accession MIMAT0022692
Description Homo sapiens hsa-miR-181b-3p mature miRNA
Sequence 76 - CUCACUGAACAAUGAAUGCAA - 96
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575