miRBase entry: hsa-mir-183

Stem-loop hsa-mir-183


Accession
MI0000273
Symbol
HGNC: MIR183
Description
Homo sapiens hsa-mir-183 precursor miRNA mir-183
Gene
family?
RF00663; mir-183

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR183 is a microRNA that has been studied in various biological contexts, including its role in ototoxicity and cancer metastasis [PMC6163699; PMC8074316].'>PMC8074316].. In a study involving mice, researchers compared the levels of MIR183 in the serum to its levels in the cochlea and kidney following ototoxicity using quantitative reverse transcription PCR (qRT-PCR) [PMC6163699]. Additionally, MIR183 has been implicated in human cancer, with a study on sporadic medullary thyroid carcinomas (MTCs) finding a close association between MIR183 expression and lymph node metastasis [PMC8074316]. These findings suggest that MIR183 may serve as a potential biomarker for both ototoxicity in mice and for the progression of certain human cancers [PMC6163699; PMC8074316]..

Literature search
202 open access papers mention hsa-mir-183
(1028 sentences)

Sequence

98230 reads, 635 reads per million, 129 experiments
ccgcagagugugacuccuguucugugUAUGGCACUGGUAGAAUUCACUgugaacagucucagucaGUGAAUUACCGAAGGGCCAUAAacagagcagagacagauccacga
.((..((.(.((.(((.((((((((.((((((.((((((..(((((((((((......)))..))))))))))))..)).)))))).))))))))))).)).)))..)).

Structure
c  ca  g g  a   c        g      A  --    GA        --   ac 
 cg  ga u ug cuc uguucugu UAUGGC CU  GGUA  AUUCACUg  uga  a
 ||  || | || ||| |||||||| |||||| ||  ||||  ||||||||  |||   
 gc  cu a ac gag acgagaca AUACCG GA  CCAU  UAAGUGac  acu  g
a  ac  - g  a   -        A      G  AG    --        ug   cu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression was later confirmed in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr7: 129774905-129775014 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-183
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-183 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-183-5p

Accession MIMAT0000261
Description Homo sapiens hsa-miR-183-5p mature miRNA
Sequence 27 - UAUGGCACUGGUAGAAUUCACU - 48
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-183-3p

Accession MIMAT0004560
Description Homo sapiens hsa-miR-183-3p mature miRNA
Sequence 66 - GUGAAUUACCGAAGGGCCAUAA - 87
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540