MIR183 is a microRNA that has been studied in various biological contexts, including its role in ototoxicity and cancer metastasis [PMC6163699; PMC8074316].'>PMC8074316].. In a study involving mice, researchers compared the levels of MIR183 in the serum to its levels in the cochlea and kidney following ototoxicity using quantitative reverse transcription PCR (qRT-PCR) [PMC6163699]. Additionally, MIR183 has been implicated in human cancer, with a study on sporadic medullary thyroid carcinomas (MTCs) finding a close association between MIR183 expression and lymph node metastasis [PMC8074316]. These findings suggest that MIR183 may serve as a potential biomarker for both ototoxicity in mice and for the progression of certain human cancers [PMC6163699; PMC8074316]..
c ca g g a c g A -- GA -- ac cg ga u ug cuc uguucugu UAUGGC CU GGUA AUUCACUg uga a || || | || ||| |||||||| |||||| || |||| |||||||| ||| gc cu a ac gag acgagaca AUACCG GA CCAU UAAGUGac acu g a ac - g a - A G AG -- ug cu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000261 |
| Description | Homo sapiens hsa-miR-183-5p mature miRNA |
| Sequence | 27 - UAUGGCACUGGUAGAAUUCACU - 48 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004560 |
| Description | Homo sapiens hsa-miR-183-3p mature miRNA |
| Sequence | 66 - GUGAAUUACCGAAGGGCCAUAA - 87 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|