MIR183, a type of microRNA, was investigated in a study comparing its levels in the serum of mice with ototoxicity to levels in the cochlea and kidney using qRT-PCR [PMC6163699]. The study aimed to understand the role of MIR183 in ototoxicity and its potential as a biomarker [PMC6163699]. Additionally, MIR183 was found to be closely associated with lymph node metastasis in 54 sporadic MTCs [PMC8074316]. This suggests that MIR183 may play a role in the progression and metastasis of medullary thyroid carcinoma [PMC8074316]. The findings highlight the potential clinical significance of MIR183 as a biomarker for lymph node metastasis and its potential as a therapeutic target for medullary thyroid carcinoma [PMC8074316]. Further research is needed to elucidate the underlying mechanisms by which MIR183 contributes to these processes [PMC8074316]. The qRT-PCR analysis used in these studies provides quantitative data on microRNA expression levels, allowing for accurate comparisons between different tissues and conditions [PMC6163699]. Overall, these studies shed light on the involvement of MIR183 in ototoxicity and lymph node metastasis, providing valuable insights for future research and clinical applications [PMC6163699] [PMC8074316].
c ca g g a c g A -- GA -- ac cg ga u ug cuc uguucugu UAUGGC CU GGUA AUUCACUg uga a || || | || ||| |||||||| |||||| || |||| |||||||| ||| gc cu a ac gag acgagaca AUACCG GA CCAU UAAGUGac acu g a ac - g a - A G AG -- ug cu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000261 |
Description | Homo sapiens hsa-miR-183-5p mature miRNA |
Sequence | 27 - UAUGGCACUGGUAGAAUUCACU - 48 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004560 |
Description | Homo sapiens hsa-miR-183-3p mature miRNA |
Sequence | 66 - GUGAAUUACCGAAGGGCCAUAA - 87 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|