miRBase entry: hsa-mir-199b

Stem-loop hsa-mir-199b


Accession
MI0000282
Symbol
HGNC: MIR199B
Description
Homo sapiens hsa-mir-199b precursor miRNA mir-199
Gene
family?
RF00144; mir-199

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR199B is a microRNA implicated in various biological processes and disease states. Overexpression of MIR199B does not significantly alter HIF-1α mRNA or NFκB mRNA and protein levels [PMC3645752]. The specific PCR primers for MIR199B have been designed to amplify a 66 bp product [PMC3645752]. MIR199B deficiency in a mouse model leads to increased levels of ACR, BUN, Cr, and proteinuria, suggesting that MIR199B has a protective role that is lost when it is absent [PMC8257373]. In the context of SARS-CoV-2 infection, MIR199B is one of the differentially expressed pri-miRNAs that show increased levels in patients' plasma [PMC9677482]. In breast cancer (BC), MIR199B has been reported as up-regulated [PMC3828615], and it has been studied for its potential role in VEGF transcriptional activation and secretion [PMC4737258]. The microRNA also plays a role in cancer biology by inhibiting the transcription factor HES1, which leads to reduced pluripotency in cancer stem cells and decreased growth of medulloblastoma [PMC3645752]. Furthermore, higher expression levels of MIR199B are associated with shorter progression-free survival (PFS) in patients with certain cancers [PMC6183594].

Literature search
143 open access papers mention hsa-mir-199b
(531 sentences)

Sequence

3258064 reads, 6238 reads per million, 155 experiments
ccagaggacaccuccacuccgucuaCCCAGUGUUUAGACUAUCUGUUCaggacucccaaauuguACAGUAGUCUGCACAUUGGUUAggcugggcuggguuagacccucgg
((.((((.....(((((((.(((((.(((((((.(((((((.((((.(((..........))).))))))))))).))))))).))))).))).))))......))))))

Structure
  a    -acacc    -   c     C       U       U    U   gacu 
cc gagg      ucca cuc gucua CCAGUGU UAGACUA CUGU Cag    c
|| ||||      |||| ||| ||||| ||||||| ||||||| |||| |||     
gg cucc      gggu ggg cggAU GGUUACA GUCUGAU GACA guu    c
  -    cagauu    c   u     U       C       -    u   aaac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised 5' miR has been validated in zebrafish, the ends mapped by cloning [2], and later verified in human [3].

Genome context
chr9: 128244721-128244830 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-199b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-199b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-199b-5p

Accession MIMAT0000263
Description Homo sapiens hsa-miR-199b-5p mature miRNA
Sequence 26 - CCCAGUGUUUAGACUAUCUGUUC - 48
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-199b-3p

Accession MIMAT0004563
Description Homo sapiens hsa-miR-199b-3p mature miRNA
Sequence 65 - ACAGUAGUCUGCACAUUGGUUA - 86
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540