MIR205, identified as a microRNA, plays a role in the epithelial-mesenchymal transition (EMT) process by downregulating several markers associated with this process, including CD44, TAZ, E2A.E12, Twist, Snail-1, and CK5 [PMC5705145]. Additionally, PRKCE is highlighted as one of the six target genes of MIR205 [PMC4052696]. The microRNA spectrum including MIR205 also encompasses miR488*, miR125, mir185, miR1 and miR31 [PMC4742123]. Furthermore, MIR205 is part of a panel of microRNAs that includes miR16, miR200c, miR21, miR221 and miR34a which have been demonstrated to have predictive value in tumor presence with an area under the curve (AUC) statistic of 0.85 [PMC4815774].
aaagaucc a aa gcuu UC C ucuca
ucag c uccaugu cucuug CUUCAUUCCAC GGAGUCUG u
|||| | ||||||| |||||| ||||||||||| |||||||| a
aguc g agguacg gaggaC GAAGUGAGGUG CUUUAGac c
------ac - -- ---- UU A caacc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000266 |
| Description | Homo sapiens hsa-miR-205-5p mature miRNA |
| Sequence | 34 - UCCUUCAUUCCACCGGAGUCUG - 55 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0009197 |
| Description | Homo sapiens hsa-miR-205-3p mature miRNA |
| Sequence | 71 - GAUUUCAGUGGAGUGAAGUUC - 91 |
| Evidence |
experimental
454 [4] |
| Database links |
|
| Predicted targets |
|
|