MIR205, a type of microRNA, has been found to reduce the expression of various markers associated with the epithelial-mesenchymal process, including CD44, TAZ, E2A.E12, Twist, Snail-1, and mesenchymal CK5 [PMC5705145]. One of the target genes of MIR205 is PRKCE [PMC4052696]. Additionally, MIR205 has been identified alongside other microRNAs such as miR488*, miR125, mir185, miR1 and miR31 [PMC4742123]. Furthermore, a study found that MIR205 is among a group of microRNAs that can predict the presence of a tumor with an AUC value of 0.85 [PMC4815774].
aaagaucc a aa gcuu UC C ucuca ucag c uccaugu cucuug CUUCAUUCCAC GGAGUCUG u |||| | ||||||| |||||| ||||||||||| |||||||| a aguc g agguacg gaggaC GAAGUGAGGUG CUUUAGac c ------ac - -- ---- UU A caacc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000266 |
Description | Homo sapiens hsa-miR-205-5p mature miRNA |
Sequence | 34 - UCCUUCAUUCCACCGGAGUCUG - 55 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0009197 |
Description | Homo sapiens hsa-miR-205-3p mature miRNA |
Sequence | 71 - GAUUUCAGUGGAGUGAAGUUC - 91 |
Evidence |
experimental
454 [4] |
Database links | |
Predicted targets |
|