miRBase entry: hsa-mir-205

Stem-loop hsa-mir-205


Accession
MI0000285
Symbol
HGNC: MIR205
Description
Homo sapiens hsa-mir-205 precursor miRNA mir-205
Gene
family?
RF00656; mir-205

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR205, identified as a microRNA, plays a role in the epithelial-mesenchymal transition (EMT) process by downregulating several markers associated with this process, including CD44, TAZ, E2A.E12, Twist, Snail-1, and CK5 [PMC5705145]. Additionally, PRKCE is highlighted as one of the six target genes of MIR205 [PMC4052696]. The microRNA spectrum including MIR205 also encompasses miR488*, miR125, mir185, miR1 and miR31 [PMC4742123]. Furthermore, MIR205 is part of a panel of microRNAs that includes miR16, miR200c, miR21, miR221 and miR34a which have been demonstrated to have predictive value in tumor presence with an area under the curve (AUC) statistic of 0.85 [PMC4815774].

Literature search
903 open access papers mention hsa-mir-205
(4567 sentences)

Sequence

715228 reads, 4098.0 reads per million, 146 experiments
aaagauccucagacaauccaugugcuucucuugUCCUUCAUUCCACCGGAGUCUGUcucauacccaaccaGAUUUCAGUGGAGUGAAGUUCAggaggcauggagcugaca
........((((.(..(((((((....((((((..(((((((((((.((((((((.............)))))))).)))))))))))..))))))))))))))))))..

Structure
aaagaucc    a aa       gcuu      UC           C        Ucuca 
        ucag c  uccaugu    cucuug  CUUCAUUCCAC GGAGUCUG     u
        |||| |  |||||||    ||||||  ||||||||||| ||||||||     a
        aguc g  agguacg    gaggAC  GAAGUGAGGUG CUUUAGac     c
------ac    - --       ----      UU           A        caacc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
chr1: 209432133-209432242 [+]

Disease association
hsa-mir-205 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-205 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-205 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-205-5p

Accession MIMAT0000266
Description Homo sapiens hsa-miR-205-5p mature miRNA
Sequence 34 - UCCUUCAUUCCACCGGAGUCUGU - 56
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-205-3p

Accession MIMAT0009197
Description Homo sapiens hsa-miR-205-3p mature miRNA
Sequence 71 - GAUUUCAGUGGAGUGAAGUUCA - 92
Evidence experimental
454 [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341