miRBase entry: hsa-mir-210

Stem-loop hsa-mir-210


Accession
MI0000286
Symbol
HGNC: MIR210
Description
Homo sapiens hsa-mir-210 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR210 is a microRNA associated with inflammatory and hypoxic responses, and its expression is indicative of its role in various physiological and pathological processes [PMC7215947]. In the context of Parkinson's disease (PD), MIR210, along with other microRNAs, has been observed to change in expression levels, suggesting a potential role in the disease's pathogenesis [PMC7215947]. Additionally, MIR210 has been identified as a pro-angiogenic factor within a secretory body from the human ADSC line, which implies its therapeutic potential in chronic wound healing [PMC9742286]. In cancer research, MIR210 overexpression has been correlated with advanced stages of human hepatocellular carcinoma (HCC), poor survival outcomes, and higher recurrence rates post-chemotherapy [PMC8799276]. Experimental studies using transgenic mice have further established the importance of MIR210 by utilizing doxycycline-inducible transgenic mice to investigate its functions [PMC8088433]. The regulation of MIR210 by hypoxia-inducible factor 1-alpha (HIF-1α) has been demonstrated in activated T cells, reinforcing the connection between hypoxia responses and MIR210 expression [PMC3996831]. This relationship is further supported by findings that show HIF-1α's regulation precedes and potentially induces MIR210 expression under varying oxygen levels [PMC3996831], highlighting its significance in both cancer progression and immune responses as well as metabolic activity [PMC6862702].

Literature search
334 open access papers mention hsa-mir-210
(2490 sentences)

Sequence

53209 reads, 166 reads per million, 159 experiments
acccggcagugccuccaggcgcagggcAGCCCCUGCCCACCGCACACUGcgcugccccagacccaCUGUGCGUGUGACAGCGGCUGAucugugccugggcagcgcgaccc
....((..((((.(((((((((((..(((((.(((..(((((((((.((.((((...))).).)).)))))).))).))).)))))..)))))))))))..))))..)).

Structure
accc  ca    -c           gg     C   CC   -      C  c -   c 
    gg  gugc  uccaggcgcag  cAGCC CUG  CAC CGCACA UG g cug  
    ||  ||||  |||||||||||  ||||| |||  ||| |||||| || | ||| c
    cc  cgcg  ggguccguguc  GUCGG GAC  GUG GCGUGU ac c gac  
---c  ag    ac           uA     C   -A   U      C  c a   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2].

Genome context
chr11: 568089-568198 [-]

Disease association
hsa-mir-210 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-210-3p

Accession MIMAT0000267
Description Homo sapiens hsa-miR-210-3p mature miRNA
Sequence 66 - CUGUGCGUGUGACAGCGGCUGA - 87
Evidence experimental
cloned [2-4], Illumina [5]
Database links
Predicted targets

Mature hsa-miR-210-5p

Accession MIMAT0026475
Description Homo sapiens hsa-miR-210-5p mature miRNA
Sequence 28 - AGCCCCUGCCCACCGCACACUG - 49
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  4. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575

  5. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45