Accession
MI0000286
Symbol
HGNC:
MIR210
Description
Homo sapiens
hsa-mir-210 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR210 is a microRNA that is associated with neuroinflammation and hypoxia in Parkinson's disease (PD) [PMC7215947]. In a study, changes in the relative expression levels of three microRNAs, including MIR210, were assessed in a pre-motor PD model [PMC7215947]. A hydrogel loaded with the secretory body from the human ADSC line HATMSC2 was found to have high levels of MIR210, indicating its potential in chronic wound treatment [PMC9742286]. Overexpression of MIR210 was observed in advanced hepatocellular carcinoma (HCC) and was associated with higher disease stage, poor overall and disease-free survival, and high incidence of recurrence after chemotherapy [PMC8799276]. Transgenic mouse experiments using doxycycline-inducible transgenic mice showed the use of MIR210 (Tg-210) [PMC8088433]. HIF-1α was found to be required for the induction of MIR210 in activated T cells, suggesting that HIF-1 acts upstream of miR-210 [PMC3996831]. In addition to MIR210, miR21 and miR155 were also studied for their cancer and immune-related functions [PMC6862702]. MIR210 is a hypoxia-associated microRNA that has been implicated in neuroinflammation and various diseases such as Parkinson's disease (PD) and hepatocellular carcinoma (HCC) [PMC7215947] [PMC9742286] [PMC8799276] [PMC8088433] [PMC3996831] [PMC6862702].
Literature search
334 open access papers mention hsa-mir-210
(2490 sentences)
(2490 sentences)
Sequence
53214
reads,
423
reads per million, 159 experiments
acccggcagugccuccaggcgcagggcAGCCCCUGCCCACCGCACACUGcgcugccccagacccaCUGUGCGUGUGACAGCGGCUGAucugugccugggcagcgcgaccc
....((..((((.(((((((((((..(((((.(((..(((((((((.((.((((...))).).)).)))))).))).))).)))))..)))))))))))..))))..)).
....((..((((.(((((((((((..(((((.(((..(((((((((.((.((((...))).).)).)))))).))).))).)))))..)))))))))))..))))..)).
Structure
accc ca -c gg C CC - C c - c
gg gugc uccaggcgcag cAGCC CUG CAC CGCACA UG g cug
|| |||| ||||||||||| ||||| ||| ||| |||||| || | ||| c
cc cgcg ggguccguguc GUCGG GAC GUG GCGUGU ac c gac
---c ag ac uA C -A U C c a c
Annotation confidence
High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2].
Genome context
chr11: 568089-568198 [-]
Disease association
hsa-mir-210 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-210-3p
| Accession | MIMAT0000267 |
| Description | Homo sapiens hsa-miR-210-3p mature miRNA |
| Sequence | 66 - CUGUGCGUGUGACAGCGGCUGA - 87 |
| Evidence |
experimental
cloned [2-4], Illumina [5] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-210-5p
| Accession | MIMAT0026475 |
| Description | Homo sapiens hsa-miR-210-5p mature miRNA |
| Sequence | 28 - AGCCCCUGCCCACCGCACACUG - 49 |
| Evidence |
experimental
Illumina [5] |
| Database links |
|
| Predicted targets |
|
References
|
