miRBase entry: hsa-mir-181a-1

Stem-loop hsa-mir-181a-1


Accession
MI0000289
Symbol
HGNC: MIR181A1
Description
Homo sapiens hsa-mir-181a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR181A1, identified as the hsa-miR-181a-1 gene, is a microRNA located on chromosome 1q32.1 and is involved in the regulation of gene expression [PMC4342183]. ETV6/RUNX1 negatively regulates MIR181A1 by binding to its regulatory region, thus maintaining low expression levels of hsa-mir-181a-1 and reducing miR-181a-mediated translational repression of ETV6/RUNX1 [PMC4651427]. The intergenic SNP rs427790 between MIR181A1 and NR5A2 has been identified as an expression quantitative trait locus (eQTL) in the testis and basal ganglia [PMC6071032]. Furthermore, inhibition of MSK1 activation decreases STAT3 recruitment to the MIR181A1 promoter, suggesting a regulatory mechanism involving MSK1 in MIR181A1 expression [PMC4666837]. A set of 10 genes has been found to be downregulated by MIR181A1 or miR181b1, indicating a potential regulatory network influenced by this microRNA cluster [PMC7108928]. Overexpression studies have shown that only simultaneous overexpression of both MIR181A1 and miR181b1 can enhance 3D growth in 3KT cells, suggesting a cooperative effect between these microRNAs [PMC7108928]. Additionally, amplification of MIR181A1 has been observed in approximately 12% of breast cancer samples according to TCGA database analysis [PMC4666837], indicating its potential role in oncogenesis.

Literature search
486 open access papers mention hsa-mir-181a-1
(2602 sentences)

Sequence

2184895 reads, 3108 reads per million, 142 experiments
ugaguuuugagguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauuaaaaucaaaACCAUCGACCGUUGAUUGUACCcuauggcuaaccaucaucuacucca
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..

Structure
-u    -uu   -    -   uc  u A   U      CU       A    g  au 
  gagu   uga gguu gcu  ag g ACA UCAACG  GUCGGUG GUuu ga  u
  ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
  cuca   acu ccaa cgg  uc C UGU AGUUGC  CAGCUAC CAaa cu  a
ac    ucu   a    u   ua  C A   U      --       -    a  aa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 198859044-198859153 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181a-5p

Accession MIMAT0000256
Description Homo sapiens hsa-miR-181a-5p mature miRNA
Sequence 24 - AACAUUCAACGCUGUCGGUGAGU - 46
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-181a-3p

Accession MIMAT0000270
Description Homo sapiens hsa-miR-181a-3p mature miRNA
Sequence 64 - ACCAUCGACCGUUGAUUGUACC - 85
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73