miRBase entry: hsa-mir-181a-1

Stem-loop hsa-mir-181a-1


Accession
MI0000289
Symbol
HGNC: MIR181A1
Description
Homo sapiens hsa-mir-181a-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR181A1 is a gene located on chromosome 1q32.1 [PMC4342183]. Previous findings and current data suggest a new mechanism of action for the ETV6/RUNX1 fusion gene, in which it binds to the regulatory region of MIR181A1, resulting in low expression of hsa-mir-181a-1 [PMC4651427]. This binding reduces the miR-181a-mediated translational repression of ETV6/RUNX1. An intergenic SNP, rs427790, located between MIR181A1 and NR5A2, is an expression quantitative trait locus (eQTL) hit in the testis and basal ganglia [PMC6071032]. Blocking MSK1 activation or knockdown also reduces STAT3 recruitment at the MIR181A1 promoter [PMC4666837]. Analysis identified a 10-gene set of downregulated genes predicted to be bound by MIR181A1 or miR181b1, including NEXMIF, DEK, DTX4, FBXO33, MEAF6, MED8, MFSD6, PLEKHJ1, RBBP7 and SCOC [PMC7108928]. Overexpression of both MIR181A1 and miR181b enhanced growth in 3D cultures compared to single miRNA overexpression [PMC7108928]. Additionally, MIR181A1 amplification was found in approximately 12% of breast cancer samples [PMC4666837]. The expression of both members of the Mir181ab cluster (MIR181A1 and Mir18b) is necessary for inducing an oncogenic phenotype in KRAS-mutated tumors [PMC7108928].

Literature search
486 open access papers mention hsa-mir-181a-1
(2602 sentences)

Sequence

2184921 reads, 4186 reads per million, 142 experiments
ugaguuuugagguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauuaaaaucaaaACCAUCGACCGUUGAUUGUACCcuauggcuaaccaucaucuacucca
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..

Structure
-u    -uu   -    -   uc  u A   U      CU       A    g  au 
  gagu   uga gguu gcu  ag g ACA UCAACG  GUCGGUG GUuu ga  u
  ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
  cuca   acu ccaa cgg  uc C UGU AGUUGC  CAGCUAC CAaa cu  a
ac    ucu   a    u   ua  C A   U      --       -    a  aa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 198859044-198859153 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-181a-5p

Accession MIMAT0000256
Description Homo sapiens hsa-miR-181a-5p mature miRNA
Sequence 24 - AACAUUCAACGCUGUCGGUGAGU - 46
Evidence experimental
cloned [2,4-6]
Database links
Predicted targets

Mature hsa-miR-181a-3p

Accession MIMAT0000270
Description Homo sapiens hsa-miR-181a-3p mature miRNA
Sequence 64 - ACCAUCGACCGUUGAUUGUACC - 85
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  5. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73