Accession
MI0000289
Symbol
HGNC:
MIR181A1
Description
Homo sapiens
hsa-mir-181a-1 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR181A1, identified as the hsa-miR-181a-1 gene, is a microRNA located on chromosome 1q32.1 and is involved in the regulation of gene expression [PMC4342183]. ETV6/RUNX1 negatively regulates MIR181A1 by binding to its regulatory region, thus maintaining low expression levels of hsa-mir-181a-1 and reducing miR-181a-mediated translational repression of ETV6/RUNX1 [PMC4651427]. The intergenic SNP rs427790 between MIR181A1 and NR5A2 has been identified as an expression quantitative trait locus (eQTL) in the testis and basal ganglia [PMC6071032]. Furthermore, inhibition of MSK1 activation decreases STAT3 recruitment to the MIR181A1 promoter, suggesting a regulatory mechanism involving MSK1 in MIR181A1 expression [PMC4666837]. A set of 10 genes has been found to be downregulated by MIR181A1 or miR181b1, indicating a potential regulatory network influenced by this microRNA cluster [PMC7108928]. Overexpression studies have shown that only simultaneous overexpression of both MIR181A1 and miR181b1 can enhance 3D growth in 3KT cells, suggesting a cooperative effect between these microRNAs [PMC7108928]. Additionally, amplification of MIR181A1 has been observed in approximately 12% of breast cancer samples according to TCGA database analysis [PMC4666837], indicating its potential role in oncogenesis.
Literature search
486 open access papers mention hsa-mir-181a-1
(2602 sentences)
(2602 sentences)
Sequence
2184921
reads,
4186
reads per million, 142 experiments
ugaguuuugagguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauuaaaaucaaaACCAUCGACCGUUGAUUGUACCcuauggcuaaccaucaucuacucca
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..
Structure
-u -uu - - uc u A U CU A g au gagu uga gguu gcu ag g ACA UCAACG GUCGGUG GUuu ga u |||| ||| |||| ||| || | ||| |||||| ||||||| |||| || a cuca acu ccaa cgg uc C UGU AGUUGC CAGCUAC CAaa cu a ac ucu a u ua C A U -- - a aa
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr1: 198859044-198859153 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-1
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-181a-1 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-181a-5p
| Accession | MIMAT0000256 |
| Description | Homo sapiens hsa-miR-181a-5p mature miRNA |
| Sequence | 24 - AACAUUCAACGCUGUCGGUGAGU - 46 |
| Evidence |
experimental
cloned [2,4-6] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-181a-3p
| Accession | MIMAT0000270 |
| Description | Homo sapiens hsa-miR-181a-3p mature miRNA |
| Sequence | 64 - ACCAUCGACCGUUGAUUGUACC - 85 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
References
|
