Accession
MI0000289
Symbol
HGNC:
MIR181A1
Description
Homo sapiens
hsa-mir-181a-1 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR181A1 is a gene located on chromosome 1q32.1 [PMC4342183]. Previous findings and current data suggest a new mechanism of action for the ETV6/RUNX1 fusion gene, in which it binds to the regulatory region of MIR181A1, resulting in low expression of hsa-mir-181a-1 [PMC4651427]. This binding reduces the miR-181a-mediated translational repression of ETV6/RUNX1. An intergenic SNP, rs427790, located between MIR181A1 and NR5A2, is an expression quantitative trait locus (eQTL) hit in the testis and basal ganglia [PMC6071032]. Blocking MSK1 activation or knockdown also reduces STAT3 recruitment at the MIR181A1 promoter [PMC4666837]. Analysis identified a 10-gene set of downregulated genes predicted to be bound by MIR181A1 or miR181b1, including NEXMIF, DEK, DTX4, FBXO33, MEAF6, MED8, MFSD6, PLEKHJ1, RBBP7 and SCOC [PMC7108928]. Overexpression of both MIR181A1 and miR181b enhanced growth in 3D cultures compared to single miRNA overexpression [PMC7108928]. Additionally, MIR181A1 amplification was found in approximately 12% of breast cancer samples [PMC4666837]. The expression of both members of the Mir181ab cluster (MIR181A1 and Mir18b) is necessary for inducing an oncogenic phenotype in KRAS-mutated tumors [PMC7108928].
Literature search
486 open access papers mention hsa-mir-181a-1
(2602 sentences)
(2602 sentences)
Sequence
2184921
reads,
4186
reads per million, 142 experiments
ugaguuuugagguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauuaaaaucaaaACCAUCGACCGUUGAUUGUACCcuauggcuaaccaucaucuacucca
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..
.((((..((((((((((..((.(.(((.((((((..(((((((.((((.((.......)).))))))))))))))))).))).).))..))).)))).)))...))))..
Structure
-u -uu - - uc u A U CU A g au gagu uga gguu gcu ag g ACA UCAACG GUCGGUG GUuu ga u |||| ||| |||| ||| || | ||| |||||| ||||||| |||| || a cuca acu ccaa cgg uc C UGU AGUUGC CAGCUAC CAaa cu a ac ucu a u ua C A U -- - a aa
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr1: 198859044-198859153 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181a-1
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-181a-1 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-181a-5p
| Accession | MIMAT0000256 |
| Description | Homo sapiens hsa-miR-181a-5p mature miRNA |
| Sequence | 24 - AACAUUCAACGCUGUCGGUGAGU - 46 |
| Evidence |
experimental
cloned [2,4-6] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-181a-3p
| Accession | MIMAT0000270 |
| Description | Homo sapiens hsa-miR-181a-3p mature miRNA |
| Sequence | 64 - ACCAUCGACCGUUGAUUGUACC - 85 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
References
|
