miRBase entry: hsa-mir-215

Stem-loop hsa-mir-215


Accession
MI0000291
Symbol
HGNC: MIR215
Description
Homo sapiens hsa-mir-215 precursor miRNA mir-192
Gene
family?
RF00130; mir-192

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-215 is a microRNA (miRNA) that has been implicated in various biological processes and diseases, with a particular focus on its role in cancer. It is one of the miRNAs with fewer than 20 validated targets in miRTarBase, indicating its potential specificity in gene regulation [PMC5484592]. This miRNA has been associated with the regulation of pathways significantly overrepresented among its target genes, suggesting its involvement in critical biological functions [PMC8876010]. In soft tissue sarcoma (STS) metastasis, hsa-mir-215 and thymidylate synthase (TYMS) have been proposed as potential prognostic indicators for chemotherapeutic benefits [PMC4434893]. Additionally, hsa-mir-215's expression levels have been linked to disease stage and colorectal cancer (CRC)-specific mortality [PMC6007480]. It has shown differential expression patterns in various cancers, including upregulation in NPM1 mutated acute myeloid leukemia (AML) [PMC7851519] and a strong correlation with esophageal neoplasms [PMC6929455]. However, hsa-mir-215 expression is significantly lower in tumor tissues compared to adjacent normal colon epithelial tissue [PMC8798538], suggesting a complex role in tumorigenesis. Mechanistically, it can be inhibited by circ_0005046 acting as a miRNA sponge [PMC8233096], and it is one of the upregulated miRNAs identified by an IM signature that includes both upregulated and downregulated miRNAs associated with cancer progression [PMC3671360]. Finally, hsa-mir-215's expression patterns have been validated using pre-designed RT2 qPCR assays for accurate quantification [PMC5764254], underscoring its relevance as a biomarker for disease diagnosis or prognosis.

Literature search
102 open access papers mention hsa-mir-215
(417 sentences)

Sequence

21961 reads, 75 reads per million, 86 experiments
aucauucagaaaugguauacaggaaaAUGACCUAUGAAUUGACAGACaauauagcugaguuugUCUGUCAUUUCUUUAGGCCAAUAuucuguaugacugugcuacuucaa
...........(((((((((((((...((.((((.(((.((((((((((...........)))))))))).)))..)))).))...)))))))).)))))..........

Structure
aucauucagaa     -        aaA  A    -U   U          uaua 
           auggu auacagga   UG CCUA  GAA UGACAGACaa    g
           ||||| ||||||||   || ||||  ||| ||||||||||    c
           uguca uaugucuu   AC GGAU  CUU ACUGUCUguu    u
-aacuucaucg     g        AUA  C    UU   U          ugag 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
chr1: 220117853-220117962 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-215
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-215 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-215 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-215 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-215-5p

Accession MIMAT0000272
Description Homo sapiens hsa-miR-215-5p mature miRNA
Sequence 27 - AUGACCUAUGAAUUGACAGAC - 47
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-215-3p

Accession MIMAT0026476
Description Homo sapiens hsa-miR-215-3p mature miRNA
Sequence 64 - UCUGUCAUUUCUUUAGGCCAAUA - 86
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45