Hsa-mir-215 is a microRNA (miRNA) that has been studied in various contexts. It has been identified as one of the miRNAs with 20 or fewer validated targets in miRTarBase, along with hsa-miR-21-5p and hsa-miR-124-3p [PMC5484592]. In certain studies, hsa-mir-215 has been found to be significantly associated with target genes involved in specific pathways [PMC8876010]. It has also been suggested as a potential prognostic indicator for chemotherapeutic benefits in STS metastasis [PMC4434893]. In the context of colorectal cancer (CRC), hsa-mir-215 has shown associations with disease stage and CRC-specific mortality [PMC6007480]. Additionally, hsa-mir-215 has been found to be upregulated in NPM1 mutated AML compared to NPM1 wild-type AML [PMC7851519]. It is worth noting that hsa-mir-215 exhibits a high correlation with Esophageal Neoplasms [PMC6929455]. In tumor tissues, the expression of hsa-mir-215 is significantly lower compared to adjacent normal colon epithelial tissue [PMC8798538]. Furthermore, it has been identified as one of the miRNAs involved in specific molecular mechanisms, acting as a direct inhibitor for certain targets [PMC8233096]. In different studies, it was found to be both upregulated and downregulated depending on the context and disease type.
aucauucagaa - aaA A -U U uaua auggu auacagga UG CCUA GAA UGACAGACaa g ||||| |||||||| || |||| ||| |||||||||| c uguca uaugucuu AC GGAU CUU ACUGUCUguu u -aacuucaucg g AUA C UU U ugag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000272 |
Description | Homo sapiens hsa-miR-215-5p mature miRNA |
Sequence | 27 - AUGACCUAUGAAUUGACAGAC - 47 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026476 |
Description | Homo sapiens hsa-miR-215-3p mature miRNA |
Sequence | 64 - UCUGUCAUUUCUUUAGGCCAAUA - 86 |
Evidence |
experimental
Illumina [3] |
|