miRBase entry: hsa-mir-218-1

Stem-loop hsa-mir-218-1


Accession
MI0000294
Symbol
HGNC: MIR218-1
Description
Homo sapiens hsa-mir-218-1 precursor miRNA mir-218
Gene
family?
RF00255; mir-218

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR218-1 is a microRNA encoded within an intron of the SLIT2 gene, which plays a significant role in various biological processes, including the Wnt signaling pathway and cancer development [PMC5909645]. Overexpression of the Wnt signaling pathway leads to an increase in MIR218-1 levels, which is also reflected in the levels of its precursor form [PMC4748271]. MIR218-1 is implicated in the regulation of CUL3, a gene overexpressed in kidney and prostate cancers, and its expression is downregulated in these cancer types [PMC2683874]. In cardiovascular disease, MIR218-1 expression was consistently reduced across all four grades of diseased valve datasets [PMC7197751]. Furthermore, it was one of only three transcripts differentially expressed across all grades within these datasets [PMC7197751]. In cancer research, MIR218-1 has been shown to influence tumor angiogenesis and cell migration and invasion, highlighting its significant impact on cancer cell fate [PMC6712160]. Additionally, it has been found to be upregulated in stenotic colon segments when compared to normal colon tissue [PMC4774952], indicating its potential role in gastrointestinal diseases. The regulation of MIR218-1 can occur independently from its host gene SLIT2 as seen both in human and zebrafish studies [PMC6523689], suggesting a complex regulatory mechanism.

Literature search
177 open access papers mention hsa-mir-218-1
(1072 sentences)

Sequence

207527 reads, 775 reads per million, 133 experiments
gugauaauguagcgagauuuucugUUGUGCUUGAUCUAACCAUGUgguugcgagguaugaguaaaacAUGGUUCCGUCAAGCACCAUGGaacgucacgcagcuuucuaca
(((..((.((.(((.(((.((((((.(((((((((..((((((((..((((.........)))).))))))))..))))))))).)))))).))).))).))))..))).

Structure
-   au  u  a   a   u      U         CU        gg    gag 
 gug  aa gu gcg gau uucugU GUGCUUGAU  AACCAUGU  uugc   g
 |||  || || ||| ||| |||||| |||||||||  ||||||||  ||||   u
 cau  uu cg cgc cug aaGGUA CACGAACUG  UUGGUAca  aaug   a
a   cu  -  a   a   c      C         CC        -a    agu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. later verified the expression of miR-218 in human [2].

Genome context
chr4: 20528275-20528384 [+]

Disease association
hsa-mir-218-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-218-5p

Accession MIMAT0000275
Description Homo sapiens hsa-miR-218-5p mature miRNA
Sequence 25 - UUGUGCUUGAUCUAACCAUGU - 45
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-218-1-3p

Accession MIMAT0004565
Description Homo sapiens hsa-miR-218-1-3p mature miRNA
Sequence 68 - AUGGUUCCGUCAAGCACCAUGG - 89
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540