MIR218-1 is a microRNA that is involved in various biological processes and has been found to be dysregulated in different diseases, including cancer and valve disease [PMC4748271] [PMC2683874] [PMC7197751]. Overexpression of the Wnt signaling pathway has been shown to increase the levels of MIR218-1, as well as its precursor MIR218-1, in certain cancer types [PMC4748271]. In kidney and prostate cancers, MIR218-1 is one of several dysregulated microRNAs that target the CUL3 gene [PMC2683874]. In valve disease, MIR218-1 is reduced in all grades of the disease, suggesting its potential role in disease progression [PMC7197751]. MIR218-1 is also found within the intron of SLIT2 gene and has been shown to affect tumor angiogenesis and cell migration in various cancers [PMC5909645] [PMC6712160]. Additionally, MIR218-1 is up-regulated in stenotic colon segments compared to normal colon tissue [PMC4774952]. In both human and zebrafish, MIR218-1 and its homolog miR218-2 are independently regulated microRNAs with host genes SLIT2 and SLIT3 respectively[PMC6523689]. Overall, these findings highlight the importance of MIR218-1 in different diseases and its potential as a therapeutic target.
- au u a a u U CU gg gag gug aa gu gcg gau uucugU GUGCUUGAU AACCAUGU uugc g ||| || || ||| ||| |||||| ||||||||| |||||||| |||| u cau uu cg cgc cug aaGGUA CACGAACUG UUGGUAca aaug a a cu - a a c C CC -a agu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000275 |
Description | Homo sapiens hsa-miR-218-5p mature miRNA |
Sequence | 25 - UUGUGCUUGAUCUAACCAUGU - 45 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004565 |
Description | Homo sapiens hsa-miR-218-1-3p mature miRNA |
Sequence | 68 - AUGGUUCCGUCAAGCACCAUGG - 89 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|