MIR218-1 is a microRNA encoded within an intron of the SLIT2 gene, which plays a significant role in various biological processes, including the Wnt signaling pathway and cancer development [PMC5909645]. Overexpression of the Wnt signaling pathway leads to an increase in MIR218-1 levels, which is also reflected in the levels of its precursor form [PMC4748271]. MIR218-1 is implicated in the regulation of CUL3, a gene overexpressed in kidney and prostate cancers, and its expression is downregulated in these cancer types [PMC2683874]. In cardiovascular disease, MIR218-1 expression was consistently reduced across all four grades of diseased valve datasets [PMC7197751]. Furthermore, it was one of only three transcripts differentially expressed across all grades within these datasets [PMC7197751]. In cancer research, MIR218-1 has been shown to influence tumor angiogenesis and cell migration and invasion, highlighting its significant impact on cancer cell fate [PMC6712160]. Additionally, it has been found to be upregulated in stenotic colon segments when compared to normal colon tissue [PMC4774952], indicating its potential role in gastrointestinal diseases. The regulation of MIR218-1 can occur independently from its host gene SLIT2 as seen both in human and zebrafish studies [PMC6523689], suggesting a complex regulatory mechanism.
- au u a a u U CU gg gag gug aa gu gcg gau uucugU GUGCUUGAU AACCAUGU uugc g ||| || || ||| ||| |||||| ||||||||| |||||||| |||| u cau uu cg cgc cug aaGGUA CACGAACUG UUGGUAca aaug a a cu - a a c C CC -a agu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000275 |
| Description | Homo sapiens hsa-miR-218-5p mature miRNA |
| Sequence | 25 - UUGUGCUUGAUCUAACCAUGU - 45 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004565 |
| Description | Homo sapiens hsa-miR-218-1-3p mature miRNA |
| Sequence | 68 - AUGGUUCCGUCAAGCACCAUGG - 89 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|