miRBase entry: hsa-mir-218-2

Stem-loop hsa-mir-218-2


Accession
MI0000295
Symbol
HGNC: MIR218-2
Description
Homo sapiens hsa-mir-218-2 precursor miRNA mir-218
Gene
family?
RF00255; mir-218

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR218-2 is a microRNA encoded within an intron of the SLIT3 gene and is implicated in neuron differentiation [PMC3020728]. This microRNA, along with its counterpart MIR218-1 from the SLIT2 gene, can be independently regulated in both humans and zebrafish [PMC6523689]. In the context of Alzheimer's disease (AD), MIR218-2 is among the microRNAs that are upregulated in the cortex of patients, suggesting a role in disease pathology [PMC7564652]. Notably, MIR218-2 has been identified as targeting Tau protein and its phosphorylation, which are key features of AD [PMC7564652]. In addition to its role in AD, MIR218-2 expression is influenced by genetic variants such as rs11134527 located near its hairpin sequence [PMC4439572]. Furthermore, it has been found to be downregulated in Parkinson's disease (PD) patients [PMC5288660], indicating a broader involvement in neurodegenerative diseases. The expression of MIR218-2 can also be modulated by signaling pathways such as Wnt signaling which has been shown to increase its levels [PMC4748271]. Lastly, it targets CUL3 which is overexpressed in kidney and prostate cancers; thus it may play a role in cancer biology as well [PMC2683874].

Literature search
177 open access papers mention hsa-mir-218-2
(1073 sentences)

Sequence

202171 reads, 1561 reads per million, 131 experiments
gaccagucgcugcggggcuuuccuUUGUGCUUGAUCUAACCAUGUgguggaacgauggaaacggaaCAUGGUUCUGUCAAGCACCGCGgaaagcaccgugcucuccugca
...(((..((.((((.(((((((...(((((((((..((((((((..((............))..))))))))..)))))))))...))))))).))))))....)))..

Structure
gac   --uc  u    g       uUU         CU        gg  gaacg 
   cag    gc gcgg gcuuucc   GUGCUUGAU  AACCAUGU  ug     a
   |||    || |||| |||||||   |||||||||  ||||||||  ||      
   guc    cg ugcc cgaaagG   CACGAACUG  UUGGUACa  gc     u
-ac   cucu  -    a       CGC         UC        ag  aaagg 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
chr5: 168768146-168768255 [-]

Disease association
hsa-mir-218-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-218-5p

Accession MIMAT0000275
Description Homo sapiens hsa-miR-218-5p mature miRNA
Sequence 25 - UUGUGCUUGAUCUAACCAUGU - 45
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-218-2-3p

Accession MIMAT0004566
Description Homo sapiens hsa-miR-218-2-3p mature miRNA
Sequence 67 - CAUGGUUCUGUCAAGCACCGCG - 88
Evidence experimental
cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540