WARNING: This summary was generated by AI. MIR218-2 is a microRNA encoded within an intron of the SLIT3 gene and is implicated in neuron differentiation [PMC3020728]. This microRNA, along with its counterpart MIR218-1 from the SLIT2 gene, can be independently regulated in both humans and zebrafish [PMC6523689]. In the context of Alzheimer's disease (AD), MIR218-2 is among the microRNAs that are upregulated in the cortex of patients, suggesting a role in disease pathology [PMC7564652]. Notably, MIR218-2 has been identified as targeting Tau protein and its phosphorylation, which are key features of AD [PMC7564652]. In addition to its role in AD, MIR218-2 expression is influenced by genetic variants such as rs11134527 located near its hairpin sequence [PMC4439572]. Furthermore, it has been found to be downregulated in Parkinson's disease (PD) patients [PMC5288660], indicating a broader involvement in neurodegenerative diseases. The expression of MIR218-2 can also be modulated by signaling pathways such as Wnt signaling which has been shown to increase its levels [PMC4748271]. Lastly, it targets CUL3 which is overexpressed in kidney and prostate cancers; thus it may play a role in cancer biology as well [PMC2683874].
gac --uc u g uUU CU gg gaacg cag gc gcgg gcuuucc GUGCUUGAU AACCAUGU ug a ||| || |||| ||||||| ||||||||| |||||||| || guc cg ugcc cgaaagG CACGAACUG UUGGUACa gc u -ac cucu - a CGC UC ag aaagg
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000275 |
| Description | Homo sapiens hsa-miR-218-5p mature miRNA |
| Sequence | 25 - UUGUGCUUGAUCUAACCAUGU - 45 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004566 |
| Description | Homo sapiens hsa-miR-218-2-3p mature miRNA |
| Sequence | 67 - CAUGGUUCUGUCAAGCACCGCG - 88 |
| Evidence |
experimental
cloned [2] |
|