MIR218-2 is a microRNA encoded within an intron of the SLIT3 gene [PMC5909645]. It is involved in neuron differentiation [PMC3020728]. In the cortex of Alzheimer's disease (AD) patients, MIR218-2 is upregulated [PMC7564652]. MIR218-2 has not been previously studied or reported in the brain tissue of AD patients [PMC7564652]. MIR218-2 targets Tau and its phosphorylation, as well as secretases [PMC7564652]. In Parkinson's disease (PD) patients, MIR218-2 is notably down-regulated [PMC5288660]. Overexpression of the Wnt signaling pathway increases the levels of MIR218-2 [PMC4748271]. The variant rs11134527, located outside the MIR218-2 hairpin sequence, significantly changes the expression of miR-218-5p [PMC4439572]. In kidney and prostate cancers, several dysregulated microRNAs including MIR218-1 and MIR218-2 are involved in targeting CUL3 gene expression [PMC2683874]. MIR218-1 is another microRNA encoded within an intron, specifically within the SLIT2 gene [PMC2683874]. It has been found to be downregulated in AD patients' cortex [PMC7564652'>PMC7564652'>PMC7564652]. Other dysregulated microRNAs in AD include MIR129-2, MIR1296, MIR219A1, MIR29B1, MIR375, MIR411, and MIR431 [PMC7564652]. On the other hand, upregulated microRNAs include: 199A2, 24-92A1, and 99A [PMC7564652]. These findings suggest a potential role for these dysregulated microRNAs in AD pathology [PMC7564652].
gac --uc u g uUU CU gg gaacg cag gc gcgg gcuuucc GUGCUUGAU AACCAUGU ug a ||| || |||| ||||||| ||||||||| |||||||| || guc cg ugcc cgaaagG CACGAACUG UUGGUACa gc u -ac cucu - a CGC UC ag aaagg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000275 |
Description | Homo sapiens hsa-miR-218-5p mature miRNA |
Sequence | 25 - UUGUGCUUGAUCUAACCAUGU - 45 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004566 |
Description | Homo sapiens hsa-miR-218-2-3p mature miRNA |
Sequence | 67 - CAUGGUUCUGUCAAGCACCGCG - 88 |
Evidence |
experimental
cloned [2] |
|