MIR219A1 is a microRNA gene located within a 200 kb region on chromosome 6, which is associated with several genes including HLA-DPA1, HLA-DPB1, and COL11A2 [PMC10016042]. This microRNA has been observed to be downregulated in the cortex of Alzheimer's disease (AD) patients [PMC7564652]. The downregulation of MIR219A1 in AD is consistent with previous findings, as it has been reported to be downregulated in the brain of AD patients [PMC7564652]. MIR219A1 is known to target Tau protein and its phosphorylation, which are critical processes in the development of AD pathology [PMC7564652]. The dysregulation of MIR219A1 and other miRNAs like MIR29B1 and MIR129-2 has been confirmed in the cortex of AD patients, indicating their potential role in the disease's progression [PMC7564652]. Although its exact role in AD is not fully clear, it has been shown that MIR219A1 expression decreases by 9-fold in affected individuals [PMC7564652]. Additionally, single nucleotide polymorphisms (SNPs) within MIR219A1 have shown significant associations with AD, suggesting a genetic component to its involvement with the disease [PMC4895015]. Changes in expression patterns of miRNAs including MIR219A1 have been observed across studies on neurodegenerative diseases like Alzheimer's [PMC9702351].
- c --------c c cU U A G a uau ccgc c gggc gcggcuc GAU GUCCA AC CAAUUCUcg guc g |||| | |||| ||||||| ||| ||||| || ||||||||| ||| g ggcg g cccg cgccgaG CUG CAGGU UG GUUGAGAgc cgg c g a cuccaaacc c CC - C A - ccu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000276 |
| Description | Homo sapiens hsa-miR-219a-5p mature miRNA |
| Sequence | 21 - UGAUUGUCCAAACGCAAUUCU - 41 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004567 |
| Description | Homo sapiens hsa-miR-219a-1-3p mature miRNA |
| Sequence | 62 - AGAGUUGAGUCUGGACGUCCCG - 83 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|