MIR219A1 is a microRNA that is downregulated in the brain of Alzheimer's disease (AD) patients [PMC7564652]. In the cortex of AD patients, MIR219A1 is also found to be downregulated [PMC7564652]. MIR219A1, along with other miRNAs such as MIR29B1, MIR129-2, MIR199A2, MIR92A1, and MIR1296, has been observed to be dysregulated in AD patients [PMC7564652]. Specifically, in AD patients, MIR219A1 targets Tau and its phosphorylation [PMC7564652]. In addition to its role in AD pathology, the microRNA gene MIR219A1 has been associated with significant associations with other loci in genome-wide association studies (GWAS) [PMC4895015]. Furthermore, the expression of MIR219A1 has been found to be altered in various contexts such as pre-miRNAs and miRNAs associated with specific pathways [PMC5538553]. Overall, these findings highlight the importance of understanding the role of microRNAs like MIR219A1 in AD pathology and their potential as therapeutic targets.
- c --------c c cU U A G a uau ccgc c gggc gcggcuc GAU GUCCA AC CAAUUCUcg guc g |||| | |||| ||||||| ||| ||||| || ||||||||| ||| g ggcg g cccg cgccgaG CUG CAGGU UG GUUGAGAgc cgg c g a cuccaaacc c CC - C A - ccu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000276 |
Description | Homo sapiens hsa-miR-219a-5p mature miRNA |
Sequence | 21 - UGAUUGUCCAAACGCAAUUCU - 41 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0004567 |
Description | Homo sapiens hsa-miR-219a-1-3p mature miRNA |
Sequence | 62 - AGAGUUGAGUCUGGACGUCCCG - 83 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|