miRBase entry: hsa-mir-219a-1

Stem-loop hsa-mir-219a-1


Accession
MI0000296
Symbol
HGNC: MIR219A1
Description
Homo sapiens hsa-mir-219a-1 precursor miRNA
Gene family
MIPF0000044; mir-219

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR219A1 is a microRNA that is downregulated in the brain of Alzheimer's disease (AD) patients [PMC7564652]. In the cortex of AD patients, MIR219A1 is also found to be downregulated [PMC7564652]. MIR219A1, along with other miRNAs such as MIR29B1, MIR129-2, MIR199A2, MIR92A1, and MIR1296, has been observed to be dysregulated in AD patients [PMC7564652]. Specifically, in AD patients, MIR219A1 targets Tau and its phosphorylation [PMC7564652]. In addition to its role in AD pathology, the microRNA gene MIR219A1 has been associated with significant associations with other loci in genome-wide association studies (GWAS) [PMC4895015]. Furthermore, the expression of MIR219A1 has been found to be altered in various contexts such as pre-miRNAs and miRNAs associated with specific pathways [PMC5538553]. Overall, these findings highlight the importance of understanding the role of microRNAs like MIR219A1 in AD pathology and their potential as therapeutic targets.

Literature search
70 open access papers mention hsa-mir-219a-1
(248 sentences)

Sequence

1603 reads, 64 reads per million, 91 experiments
ccgccccgggccgcggcuccUGAUUGUCCAAACGCAAUUCUcgagucuauggcuccggccgAGAGUUGAGUCUGGACGUCCCGagccgccgcccccaaaccucgagcggg
((((.(.((((.(((((((..(((.(((((.((.(((((((((.(((.........)))))))))))).)).))))))))..))))))).)))).........).)))).

Structure
-    c --------c    c       cU   U     A  G         a   uau 
 ccgc c         gggc gcggcuc  GAU GUCCA AC CAAUUCUcg guc   g
 |||| |         |||| |||||||  ||| ||||| || ||||||||| |||   g
 ggcg g         cccg cgccgaG  CUG CAGGU UG GUUGAGAgc cgg   c
g    a cuccaaacc    c       CC   -     C  A         -   ccu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2].

Genome context
chr6: 33207835-33207944 [+]

Disease association
hsa-mir-219a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-219a-5p

Accession MIMAT0000276
Description Homo sapiens hsa-miR-219a-5p mature miRNA
Sequence 21 - UGAUUGUCCAAACGCAAUUCU - 41
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-219a-1-3p

Accession MIMAT0004567
Description Homo sapiens hsa-miR-219a-1-3p mature miRNA
Sequence 62 - AGAGUUGAGUCUGGACGUCCCG - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73