MIR222 is a microRNA that has been studied in various contexts [PMC8762293]. Lentivirus-mediated transfer of the MIR222 gene has been shown to promote adipogenesis in 3T3-L1 cells, as evidenced by the up-regulation of C/EBPα and PPARγ [PMC8762293]. Additionally, the post-transcriptional interaction between MIR222 and SCD5, as well as the transcriptional regulation of MEF2C by MIR222, have been validated through in vitro and in vivo assays [PMC7584575]. Furthermore, angiotensin-2 has been found to regulate a long nonprotein-coding RNA called lncAng362, which is responsible for the production of two microRNAs involved in vascular smooth muscle cell proliferation: miR221 and MIR222 [PMC7123062]. Finally, miR21, miR124, and MIR222 have been analyzed for their expression in both small extracellular vesicles (sEVs) and medium/large extracellular vesicles (m/lEVs) [PMC10056600]. These findings highlight the diverse functions of MIR222 across various biological processes.
gcu uaggua c au - AUC ucuu gcuggaaggug cc uca ggCUCAGUAGCCAG UGUAG CUg u ||||||||||| || ||| |||||||||||||| ||||| ||| c cgaucuucuac gg agu cUGGGUCAUCGGUC ACAUC gac g --u ------ u cu U GAc uaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004569 |
Description | Homo sapiens hsa-miR-222-5p mature miRNA |
Sequence | 31 - CUCAGUAGCCAGUGUAGAUCCU - 52 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000279 |
Description | Homo sapiens hsa-miR-222-3p mature miRNA |
Sequence | 69 - AGCUACAUCUGGCUACUGGGU - 89 |
Evidence |
experimental
cloned [2-5], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|